[session] Forum Topics

I have to implement session management in an asp.net application and with mode as sql server. Any inputs on how to implement and test this? I was trying for instructions on the following web site, but i am lost [url]http://idunno.org/articles/277.aspx[/url]

Hi Guys, I am facing a very wired problem. i am building a website which toggle between the modes. 1. html forms 2. flash forms it works in all browsers except mozilla. the default i have set as: [code language="coldfusion"] <cfset session.mode = "flash"> [/code] well if forms are being …

[code=XML] <?xml version="1.0" encoding="utf-8"?> <users> <user> <name>aditi</name> <password>A802CEDA2B04377E3265FC30C3D7CE9F4FADBEA0</password> <firstname>aditi</firstname> <lastname>surname</lastname> <usertype>1</usertype> </user> <user> <name>jillian</name> <password>A802CEDA2B04377E3265FC30C3D7CE9F4FADBEA0</password> <firstname>jillian</firstname> <lastname>chen</lastname> <usertype>2</usertype> </user> </users> [/code] [COLOR="Red"]How can I search for the <name> and the <password> node so that I can authenticate the login using this XML in ASP.NET?[/COLOR] Currently I am looking at something …

I'm trying to create a simple login page by following a tutorial i saw online. I did everything it required but i got this error [B] // Check if session is not registered , redirect back to main page. // Put this code in first line of web page. Warning: …

I'm facing a problem in our application. In application we are using JSP and Java Beans. Some data are not saving properly according to session. Suppose, User 1 has been logged on. Some field values of user1 has been set in a session within the JSP page . When we …

I'm not exactly sure where to post this - in html, php, or mysql area but since this is mostly php oriented, I figure I'll post it here for starters til I get yelled at >< Background info: This is not for the general public, nor attached to any website, …

hello gents, i have two pages: page1.php takes user input, page2.php should process it and then return page1 either error or success messages. there seem to be an error(s) i cant figure out: when you fill the form with correct data you get: [code]Warning: Invalid argument supplied for foreach() in …

Hi, I have a gridview with two columns one column contains usernames and another contains an image, code above. I then have a session variable which contains the userid, [CODE]<asp:HyperLinkField DataNavigateUrlFields="Work_Request_Task_PK" DataNavigateUrlFormatString="../cus.aspx?cus={0}" Text="&lt;img src='../images/cus.gif' border='0'/&gt;" HeaderText="Add Time"></asp:HyperLinkField>[/CODE] What I want to do is compare the usernames in the gridview to …

well...im compiling rBot.exe when suddenly these errors below just appeared..does anyone knows any solutions or fixes???...thank you for your help... --------------------Configuration: rBot - Win32 Debug-------------------- Compiling... dcass.cpp C:\Documents and Settings\Visitor\Desktop\rx-asn-2-re-worked_v3\rx-asn-2-re-worked v3\includes.h(18) : fatal error C1083: Cannot open include file: 'windns.h': No such file or directory dcom.cpp C:\Documents and Settings\Visitor\Desktop\rx-asn-2-re-worked_v3\rx-asn-2-re-worked v3\includes.h(18) …

hi, I am new to Cold fusion... I have defined a session level variable in one page1.cfm as follows <cfset session.testing = "test"> and when I am trying to access it on another page page2.cfm (browser window is not closed meanwhile) it gives an error that "testing" is undefined at …

Hi All, I have an application that i m developing in VS2003 using asp.net and c# in the left navigation page I need to add the functionality to open and close a panel in the left nav. here is my code: ----> [code=asp.net]<%@ Control Language="c#" AutoEventWireup="false" Codebehind="LeftNav.ascx.cs" Inherits="CE.userControls.LeftNav" TargetSchema="http://schemas.microsoft.com/intellisense/ie5" %> …

Hi everyone! I'm working on coding my own forum and I have no problem with this, I would like to ask those of you knowledgable about the inner workings of php and mysql about which method is faster. So far I have always been determining post counts, discussions started counts …

i m using session in my website(ASP) but after logging in if i don't acccess the page for 5 minutes session expires n if i continously access some pages then after 15 minutes session expires.i have used global.asa file then same problem occurs and if i dont use global.asa then …

I have a custom class that is an entire structure within itself, many layers deep. However, this object is stored in memory through sessions. I need a way to retrieve the session variable without having to call it through a return method. An Example: This is what I currently have …

Hello all, I looked around with google for a while and couldn't find an answer to my question. I'm trying to use php to get the name (or ID) of an html tag. I need to do this because I am creating a shopping cart which has a checkbox beside …

hi to all, I have a page that contains two frames (before you start telling me that frames are not good, I know but this is the requierement from my course, what I can do?), anyway I have a main page that contains leftframe.aspx and rigthframe.aspx, everything is working ok …

hi all, i created an web application in which i have used sessions. when i run this application on IIS its working fine, but when i hosted on another webserver(EasyCgi) the sessions are not working. can anybody please help. i even used Session State and Session mode in my WEB.CONFIG …

OK, I'm new to PHP and SQL so you'll probably have to explain most tings in laimen terms! I have created a website with PHPMaker, a kind of loaning libary where stock gets loaned out and out and then returned. Now it works all ok, however I want to be …

My CD and DVD drives have been missing from My Computer and I'm running WinXP Home Edition. I've gone into the registry, deleted the upper and lower filters, ran various spyware programs. Now I attempted to do a Win XP Repair, went thru all the steps, but when it gets …

Hello, I am wanting to take an uploaded picture from one page, put it into a session and carry it to another page. Once I get to that page and the client accepts it, then store it in the database. I'm starting to get confused on how this would work …

I trying to make small personal website in PHP + MYSQL . In my database there is a table named ' tblUsers ' . I am using this table for users Login .I displayed the username of the user after the login . But how to track the userID of …

Hello everyone! I am new to JavaScript and have been using PHP, but needed to use a dynamic form for information about County/State. Here is part of the code (keep in mind I did all 50 states this way-that's well over 3000 counties): [code] <script language="JavaScript" type="text/javascript"> <!-- //first combo …

Hi everybody. here i have a problem with hashtable. i am storing hashtable in session scope and i want to validate that hashtable with javascript in next jsp . how suresh kumar

I'm having a hard time with sessions. I have a long form on 3 different pages and then a preview page of everything entered. I created the code to store the session variables on each page but on the preview page it comes up empty. I am using session_start(); on …

Hey everyone, well ill be quickly...ive gotta a JSP page indexMembers.jsp with a button "Show My Reservations" when u click on that button it calls a JFrame (with a JTable inside) with the data from the databse that the user wrote before. now if i click on another button like …

I have run into an odd situation with linking files in my application. I have written a method that returns data for other methods. When I use this method(with in the same class) I get this error from linking. Any help with this is greatly appreciated [code] RetsParse.cpp: undefined reference …

hi every body I am new but there is no time to introduce my self because i have a project to hand in no time but when i tried to lookup session bean in my servlet it give me the error: Borbean not bound //borbean is the session bean so …

Hi All, Im using C# , Visual Studio 2008, to learn a bit more about HTTP Modules and HTTP Handlers. I understand why it is used for, however in trying to absorb the basics of the code it is a bit difficult. Im trying to make a http module which …

hi everyone. i'm trying to make a (very) simple shopping cart for my class. i'm stuck on the qty update - it says it's not defined. i think it may have something to do with when i check to see if the form has been submitted yet or not. any …

Hi, I am trying to restrict access to a dynamic list page based of a login id. Essentially a person will login, be directed to the index.php page and can then click on a link to Exam Evaluation. From this page, there are two links, and they can click on …

hi, is session_id is generated by javapage in one website is equal to session_id generated by phppage????.because i integrated php pages to java pages in that website. so i maitain session based on that java page. is this possible to session_id from java page to php page, if i get …

One of my app's is timing users out around 20 minutes. I have a sessiontimeout set at 90 minutes. Please help. Here's the actual code. [code] <CFAPPLICATION NAME="Store" SESSIONMANAGEMENT="Yes" SETCLIENTCOOKIES="YES" clientmanagement="yes" sessionTimeout = #CreateTimeSpan(0, 0, 90, 0)#> [/code] I am using CF 5. I did notice in CF admin I …

I'm having some difficulty with a query I'm trying to set up. What I'm trying to do is set up a query that will populate a table that shows a list of all tests offered on the site that are active, and then show the completion status of the user …

I am facing problem in asp.net. Problem is : Session objects is not working properly.in the sense some times it will work some times not(getting empty). Plz Can anyone help me in this . Its very urgent !!!!!! Eg: In web.config - In <Sessionstate timeout=30>,but before 30 minutes only its …

I'M running a site on PHP 5.2.6, Apache 2.2.9 (shared hosting). Most of the site uses a CMS (MODx) but I have one section using home-rolled scripts. I have a file that gets included into these that checks user status by looking for the MODx session vars. On one script, …

i have multiple onchange in two different form and they are in different include files. the thing is when i try to use the first onchange ...it works and it will change the session value but if i start with second onchange it will not work and it says the …

hi all i have my lougout.php which destroys sessions and session ids on logout. I want to have same effect means i want to call this logout.php script when the user closes the "browser tab". as these are the days of "browser tabs" so this is very important for me. …

Hi Guys, I am new here in this community. I still did some stuff with JSP, but now I have a principle questions. Would be nice to receive some feedback... I wanna build up a website with several JSP pages. But I don't want to place all the content into …

this is for code [CODE] <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>Untitled Document</title> </head> <body> <form method="post" action="upload.php"> Move or Upload Folder Using PHP FTP Functions<br /> </p> <table width="373" border="1"> <tr> <td width="184">server address </td> <td width="173"><input type="text" id="server_name" …

I have a web page calling another web page and I want to build a MySQL query in the calling page and pass it to the SelectCommand on the called page to show the results in a GridView control. [code=asp.net] Server.Transfer("~/Experiments/Default.aspx", True) // opens the new page Protected Sub Page_Load(ByVal …

I have a lab to do a simple chat program that has to 1. identify users 2. list online users (means to determine who's logged out and who has closed the page but hasn't logged out) i'm identifying users by session. I'm having problem with determining a user who hasn't …

Hi, I'v been trying to write a simple Java EE app, which deals with car renting. The entity beans and session beans are ready, so I've created a JSP for representation. It contains a single method, for init: [CODE] <%@page contentType="text/html" pageEncoding="UTF-8"%> <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN" "http://www.w3.org/TR/html4/loose.dtd"> …

Hi Everyone, I'm designing a database for a Motoring School and I've been given the following information: • Pupils book either a single lesson or a course of lessons. Pupils are allocated a particular instructor when they register with the school. Sometimes, pupils ask for their instructor to be changed. …

Hi, I'm hoping someone can give me some advice or guidance. I am using Developer Toolbox (yes I'm still trying to learn php) Right now I have an index page with 7 set links on it. Basically, a user logs in, and is brought to this index. Based on what …

[code=asp.net]singlecourse = Session("singlecourse") ename.Text = singlecourse.CourseName Session("testname") = singlecourse.CourseName Seclist = que.GetSection(singlecourse.CourseCode) Qnolist = que.GetQnumber(singlecourse.CourseCode) Session("totsec") = Seclist Session("totqno") = Qnolist Session("queslist") = queslist t1.Text = Profile.Ttime pos = InStr(t1.Text, ":") h1.Value = t1.Text.Substring(0, pos - 1) 'h2.Value = t1.Text.Substring(pos, 2) h2.Value = Right(t1.Text, t1.Text.Length - pos) End If Else …

Hi all, I have a shopping basket feature on my website which saves the product's primary key in the session array called 'cart', each one seperated by a comma, so example: '123,456,789'. Now in order to get each item from my shopping basket to paypal I need to write 2 …

I ve to Write a Python program that prints a random DNA sequence in Fasta format. That program should ask for the length of the sequence and suggest a reasonable sequence name. The session should look something like: > python randomdna.py Length: 34 >MySequence TGCGCATATTGTCTAACTATGGCTGTGGCCGGA The output must be in …

[code=aspnet] private void AddRecordToGrid() { try { datatable dt = new datable(); if (Session["SampleDataTable"] == null) { dt.Columns.Add(new DataColumn("ID", typeof(string))); dt.Columns.Add(new DataColumn("Qtr", typeof(string))); dt.Columns.Add(new DataColumn("Exp", typeof(string))); dt.Columns.Add(new DataColumn("Partner", typeof(string))); dt.Columns.Add(new DataColumn("Net", typeof(string))); dr = dt.NewRow(); } else { dt= (DataTable)Session["SampleDataTable"]; } dr = dt.NewRow(); if (dr.IsNull(0)) { //dr = dt.NewRow(); …

Hello everybody, I'm trying to write a php script to read rss feeds. Since I began, I found it is much harder than I expected, because the xml structures are very different, and they need to be interpreted differently everytime. I'm using [CODE]simplexml_load_file()[/CODE] to read the xml code easily and …

I need to draw a use case diagram for the following: [LIST=1] [LIST] [/LIST] [/LIST]Each member carries a membership card, which is date stamped every time they attend a training session. Their attendance is also recorded in an attendance ledger. Members pay a small fee for attending any session. [LIST=] …