199,114 Archived Topics
Remove Filter  | |
| | So We will create a java program but i don't know how to start it. We should use OOP in this one. And there should be minimum of 3 classes (including the main).. Buy n’ Sell An electronics and appliance store would like to install a kiosk for customer use. …  |
| | So We will create a java program but i don't know how to start it. We should use OOP in this one. And there should be minimum of 3 classes (including the main).. Buy n’ Sell An electronics and appliance store would like to install a kiosk for customer use. …  |
| | Hi, this is what i've got so far: [CODE]$sql = "SELECT * FROM ".$_SESSION[dbprefix]."users, user_skills WHERE user_skills.userid=users.id AND ((users.username LIKE '%" . $queryString . "%') OR (users.email LIKE '%" . $queryString . "%') OR (users.firstname LIKE '%" .$queryString . "%') OR (users.lastname LIKE '%" . $queryString . "%') OR (user_skills.skill … |
 | hi guys, i have confusion about comparing dates in php. i want to compare birth date with current date. here is my code. i hope u will me to solved out this problem. thanks [CODE] <?php //code for get values from session session_start(); if(isset($_SESSION['I'])){ //this code will get email id … |
| | I'm wondering if it is possible to skip certain fields in the mysql table in a sql statement. Here is what I mean: I have a table that has the following columns: firstname lastname phone dob Suppose I write the following statement: $[CODE]mysql_query=("insert db_table (firstname, lastname, phone) VALUES ('$firstname' ,'$lastname', … |
| | [B]Hej i am getting the error:[/B] [CODE]error C2440: 'initializing' : cannot convert from 'int *' to 'GarbagePointer<T>' 1> with 1> [ 1> T=int 1> ] 1> Constructor for class 'GarbagePointer<T>' is declared 'explicit' 1> with 1> [ 1> T=int 1> ][/CODE] -------------------------- But i really dont know how to either …  |
| | im new to java and need help with this code. i need to show stars to represent the numbers which have been entered. so far my for loop is only showing the one star, how can i get it to show the number of stars which represent the amount of … |
| | Hi everybody..Here's an interesting problem to solve. I have a text file like this (also attached): [CODE]>first TTCCCAAAAAAGACCTACTAAGTCAAGCGGATGCGTTTTGTGTCTTATGG AAAGTCCCTGACGGATACGAGGCTTTGGGTGATTCGGTACGAATGATTCG GTTACCAGAACTTACCGAAGAAGAAATGGGACGAACCGAGGTTTCTCGTT CGTGTGCTAATCCTACATTCAAACATCGATTTCGATCAGAGTTTGTTTTT CATGAAGAACAGACATTCGTATTACGTGTTTACGATGAAGATTTGAGGTA >firsta TTCCCAAAAAAGACCTACTAAGTCAAGCGGATGCGTTTTGTGTCTTATGG AAAGTCCCTGACGGATACGAGGCTTTGG---------------------- -----------------AAGAAGAAATGGGACGAACCGAGGTTTCTCGTT CGTGTGCTAATCCTACATTCAAACATCGATTTCGATCAGAGTTT------ CATGAAGAACAGACATTCGTATTACGTGTTTACGATGAAGATTTGAGGTA[/CODE] Both >first and >firsta containing same characters except the part with hyphens. Now is it possible to write a perl script that … |
| | I have a statement in c as 3*3*3%4 and the output is 3 how is that?  |
| | I'm making a survey tool. Each respondent will be asked to answer questions on (for example) cakes. The number and types of cake will be different for each respondent. The format of the survey will be saved in a file called [I]survey.xml[/I]. So the survey may be like the following: … |
| | I want to create linked list of type LinkedList<LinkedList<Integer>>. I plan to take integer values from user (via console), create a linkedlist by adding the values. Create multiple such linked lists and then create a master linkedlist which will have individual linked lists as its elements. Example: User types 1 …  |
| | Hi i am trying to think of how the algorithm of how this question works but no matter how hard i tried, i cant think of it. Can anyone give me a hand?? Any help or tip would be greatly appreciated. Question: Given 3 classes, equilateral triangle, isosceles triangle and …  |
| | Hello all. I have a string, e.g. "Testing" and I try to convert it to byte but I get a NumberFormatException. I tried with (byte), Byte.Parsebyte. Any help? thanks |
 | Hi everyone! For some time that i don't post here a message on the forum, i've been a little out of the lineup due to school, but now that the holidays are almost start i will learn some things new :) So the problem is . . I created a … |
| | Hello all, I am enrolled in an intro to C++ class, and I need some help on our final program. Any suggestions are greatly appreciated, as I am quite new to this please don't criticize. Our program requirements require us to receive a command (I.E. delete) input as an array … |
| | May I know how to find the largest number in an array? |
| | Hi guys, This week Ive been given a problem to: Take a set list of English phrases and convert them to a set list of pirate phrases. i.e. Hello would be entered by the user and Ahoy would be printed etc. My idea is to create two arrays, One will … |
| | Hi, I am trying to use AJAX to do a simple thing of displaying the results in the same page. Clicking on the <a href tag should display the results in the same page. This is working correctly in IE but the onclick() function is not working in firefox and …  |
| | Dear team, Hi all i have implemented google data api in my project. I have downloaded the api from the below url.This api is used to delete,add,update the google contacts.I have successsfully add ,list the new contacts. [url]http://code.google.com/apis/contacts/docs/3.0/developers_guide_java.html#GettingStarted[/url] But i do no how to delete the contact using this api … |
| | |
| | Hello, I'm new to C and I'm not sure what is wrong with my code here. After I execute, I get this: Debug assertion failed! [program address] File: fgets.c Line: 60 Expression: str != NULL It's a really simple program. I'm trying to assign family data from the in file … |
| | I am creating a program which includes converting numerical grades to letter grades but I'm stuck where I have to put a counter that counts number of letters. For example if 90-100=A and 90, 96, 87, 96 are entered, to count and display something like Number of As= 4 or …  |
| | Hello all, Thanks for looking at my post and thank to anyone that provides me with the help I am looking for. This is what I am trying to do. From the parent page have a few links that would do a postback and based on the link chosen a … |
| | How would you create a certain amount of objects based on user input? Like I have an enemy class and the player chooses how many enemies they want on the screen, how would I create those objects? Thanks  |
| | is it possible to create an index using substr ? say for example i have a field called num which has char(8) as its datatype and length. an example of num's value would be something like 09092010 now what i want is to create an index using the last 4 … |
| | Hi! Could someone tell me please how to configure MySQL DB for storing both latin and cyrillic data sets in the same table? Thanks! |
| | below is the code for traversing a binary tree without using recursion but the problem with the code is we require array of pointers to store all the nodes address. in below program the parameter nodes in the function push is an array of pointers to store all the node … |
| | [CODE]<HTML> <HEAD> <TITLE>TMA 02 Q4(ii)</TITLE> <SCRIPT LANGUAGE = "JAVASCRIPT"> var loc; var weather; var name; loc = window.prompt('Please enter your location',''); weather = window.prompt(`Please enter the weather`,``); name = window.prompt(`Please enter your name`,``); document.write(`London`;` Snowing`;` Meriam`); document.write(`<BR>` + `See you soon`) </SCRIPT> </HEAD> <BODY> </BODY> </HTML>[/CODE] |
| | I've been having problems with web browsing that I think may be related to Javascript. I use forum sites like [url]www.ernya.com[/url] and there I get logged out every few minutes/seconds. I've found that clearing my cache regularly seems to help a little, but it doesn't fix the problem. Other forum/avatar … |
| | Am writing this program using two classes for my school project from last 4 days. I have completed this program I think but when am running this program, it shows no error also it doesn't show any logic or runtime error..just got blank screen after compiling. Am wondering that why … |
 | [B]hi all, can anyone tell me how to open a folder on a remote machine connected on same LAN. I need to open a folder in the form "\\remote_machine\folder1\folder2\folder3"[/B] |
| | hi, I have the line of code: [code=vb.net] xlWorkBook = xlApp.Workbooks.Open("c:\mydocs\full_info.xlsm") [/code] my problem is i want to load the file without a full path, "full_info.xlsm", but i can't seem to find the right place to put it. i have the program name directory which contains folder 'bin' 'myproject' 'obj' …  |
| | Ok well I got a final tomorrow and for the life of me I can not understand recursion. I have tried and tried and no hope lol. The professor gave us a study guide and I cant not figure out 2 problems. Just wondering if anyone can help me before … |
| | [CODE] private void displayWith1Criteria(string column, string value) { Console.WriteLine("entering _1_ display method"); dbcontent = new DBtestEntities(); var studienummerQuery = from members in dbcontent.Medlemmer.Include("Retninger") where column == value orderby members.Fornavn select new { Studienr = members.Studienummer, Fornavn = members.Fornavn, Efternavn = members.Efternavn, Email = members.Email, Studiested = members.Studiested, Betaling = members.BetalingsType, … |
| | can you guys help me with my assignment given to me, my prof. said .. create a java class that will accept four Integers & develop a method that will arrange the accepted integer from highest to lowest. example: if you enter random number like: [B]10 6 7 9[/B] the …  |
| | I have some code that i need a press any key to continue command but when i put it in there it doesn't work, here's what i have: [CODE]cout << "Press any key to continue." << endl; cin.get(); [/CODE] can anyone tell me what im doing wrong? |
| | can somebody help me to put an action in a button that comes from a different class. Specifically t [code]import javax.swing.*; import java.awt.*; import java.awt.event.*; import java.io.*; class LogIn implements ActionListener { private JFrame f,f2; private JButton jLog, jCan, jReg,jOk; private JPanel j1, j2, j3, j4,j5,j6; private JTextField jText; private … |
| | hello guys, i had a problem with the automatic email sending using php.. the error states: [CODE] Warning: mail() [function.mail]: "sendmail_from" not set in php.ini or custom "From:" header missing in C:\xampp\htdocs\edith\email\index.php on line 36 [/CODE] *******index.php *******this is my code [CODE] $to = "juan@yahoo.com"; $subject = "Email testing"; $message … |
| | I'm coding a game right now and everything works great that i want to have working right now, but there's a minor bug that i know of. this is that when the player enters their name, and the name has spaces, the code just closes. here's the part of code: … |
| | Hello! I was curious if i could help any guidance on my problem. In my program i have the following class. [CODE] class Match{ String File; String Area; int Score = 0; //public Match(int Index ){ public Match(String File,String Area, int Score){ this.Area = Area; this.Score = Score; this.File = … |
| | ok so i really dont understand this whole recursive stuff and i need some help on a simple program. the problem is to write and test a recursive function max to find the largest number in a list. here is a non recursive function that ive made, [code] def Max(li): …  |
| | I understand that this code will not run because i have 2 string and 1 float type in my text file and i am storing them as int's but how do i do this?.. please someone help me this is so frustrating Here is my .txt file [QUOTE] 100 200 … |
| | I am trying to add three functions to this code so that I can add an entire list at one time to another list instead of having to add individual elements one at a time. Here is what I have so far but it is not working. [CODE]#ifndef LINKEDLIST_H #define … |
| | Hi,I have an assignment that asks me to sort the words of a text (ascending) without duplicates being included. I manage to sort the words, but I just don't understand how to remove the duplicate words after being sorted. Here's my current progress : [CODE] // load a string vector …  |
| | hi, M'soft sites documented that [CODE]RECEIVE TOP (n) FROM Target[/CODE] should fetch the n number of message from the specified queue. I am having problem with this, and do not know why because not much resource is available pertaining this. Tried finding for an answer on Klaus Aschenbrenner's book, failed. … |
| | I am having serious trouble and i don't know what exactly I'm doing wrong can someone please help. Here is the question ? In this assignment you will create a console (standalone) application. This program will allow you to select MegaBall lottery numbers. For the first 5 numbers you will … |
| | Once again, I'm having trouble with my Sudoku Game. This is the last part and I'm almost there! I just need a little bit of help. According to the rules of Sudoku, there can only be once instance of each value in each column, row, and 3x3 grid. I'm writing … |
| | GridBagLayout question My main class holds frame and gets left and right panels from other classes [CODE] /** * Matthew Schrum * 11/14/2010 */ import java.util.Random; import javax.swing.JFrame; public class Sim { public static void main(String[] args) { //variables LeftPanel leftPanel = new LeftPanel(); RightPanel rightPanel = new RightPanel(); //GUI … |
| | I have been tinkering with this for over 2 hours now and i still cannot figure out what is wrong with it. [code] private void b_Add_Click(object sender, EventArgs e) { try { string Query = "INSERT INTO tbl_Employee (s_EmpNumber, s_EmpLastName, s_EmpMiddleName, s_EmpAddress, s_EmpZip, s_EmpPhone, i_EmpPayLevel, i_EmpPayGrade) (s_String, i_Integer)" + "VALUES(" …  |
| | new in here, new in java world and new in programming at large, but i believe i can learn with the help of professionals and educators in the house. Don't be surprise am staring from such task as a newbie, it 'cos am made to believe i must find a … |
The End.