199,114 Archived Topics
Remove Filter  | |
| | Hello again guys! i have a simple question how to promt user to enter a number for example 444 or whatever and for c to print it as a 9 digit number, so if its 444 c would print it as 000000444? any help would be greatly appriciated., thanx! |
| | hi to all, i am a student, 2nd yr.college taking computer science, i want to learn about in coding in SQL except (SELECT, INSERT, UPDATE & DELETE). i just wanted to learn more complex and difficult coding, syntax, command and etc. please help me. thanks!  |
| | Hi , I have a question .. I would like to write/modify the my program ... i.e writing a function to find out which of the directories exists ..... for example : on my computer c:\\sam and in another mechine c:\\xyz ... only one dir should on my computer or …  |
| | plz i need urgent help i hav to giv project of web , a dynamic website using php.. gimme sum gud idea for topic plzzzz  |
| | If I initialize graphics in my program and then use cout the font appears bigger than normal and the cursor doesn't blink on the screen as it does when the graphics are not initialized.Is there any way I can use graphics as well as cout in my program?If yes how … |
| | What I need, is one three-dimensional array that holds: 1. Column name 2. MaxLength 3. DataType My code is close, I just can't remember the syntax for adding data to the array. Please help, Sheryl [code=vb] 'get the column information Dim c As Integer = 0 Dim x As Integer … |
| | hi am lakshman i have developed vb.net application and publish it. then i have login administrater user in vista os, then i have installed my vb.net application its working fine. But same pc same vista os now i have created new standard user then i installed same vb.net application but … |
| | I am creating vb appliction in which there are 20 forms i want to create two command buttons named current and previous forms. Can anybody tell me how i can do this ? I want guide line. Thanks in advance regards |
| | I am just trying to explore c and i was wonder what is reason behind ... segmentation fault.. but second function is workiing .. can someone explain me reason [code=c] void myfunc1(char *t) { t = t+1; t = 'l'; //it gives segmentation fault ? why } void myfunc2(char *s) …  |
| | hello everyone. i have been trying to code an MP3 player, but Java does not support this, it only supports wav, thus wma, mp3 and other music or audio formats are denied. i thought of incoporating a converter, but still the converter is even failing to make the conversion: here …  |
| | im working on an encryption program and i need some help. so far it words fine except when i enter a space. when this happens it seems to end the loop and spit out the first word. any help would be great [code] #include <iostream> #include <string> using namespace std; … |
| | how are you every one?? I am student and i just started to study SQL,and now i will start studyabout Oracal . so i want ur advice to be a good student.  |
 | HI Guys I Want to create service which monitor the another service in server,I search in google and find the coding part to do that,It works for local machine without any problem ,but I configure it to remote computer,it gave me error called "The RPC server is unavailable".I cant do … |
| | I have about 5000 columns of data that i need to convert all of it into pecentages. for shorter colums i have been using this code: {print $1/($1+$2)*100,$2/($1+$2),$3/($3+$4)*100 .....} but this is a teadious process... with help i got this sed "s/[0-9]*.[0-9]*/&~/g" | tr "\n" " " | tr "~" … |
| | :?: :idea: Anyone can help me or give me code C/C++ of detect sound from speaker ex If have sound from speaker report " currently have sound" If not "currently not sound:zzz: "  |
| | Hi there, I am somewhat new to PHP but catching on fairly well. However, I'm currently stumped. I would like to access the newest XML file in a folder. Right now my code is hardwired so everytime I want to see the newest file I have to actually enter it …  |
| | |
| | Just trying to compile some code with tcc: [CODE] #include<stdio.h> main () { int x = 10; int *p; p = &x; x = 40; printf(“%d %d %d %d”,x,&x,p,&p); } [/CODE] Trying to learn about pointers and memory addresses and I took the code right out of the book, any … |
| | Hello there Sorry in advance if this post is to big, not sure where else to go. I have just started out with python (last 2wks) with no previous Programming background. I have been really excited with the possibility of been able to program with python and to hopefully develop … |
| | I'm a newbie at posting code so I'm sorry if I make any mistakes. The 26 line won't let me compile and I don't understand why. can anyone help me??? [code=cplusplus] #include <iostream> #include <iomanip> using namespace std; double population(double pop, double birthRate, double deathRate); void printPopulations( double startPop, double … |
| | Write a C++ program that reads in the historical average monthly rainfall for NY for each month of the year and then reads in the actual monthly rainfall for each month in 2007. Finally, the program should print out a nicely formatted table showing the average rainfall for each month, … |
| | I'm having trouble implementing isalpha in the correct spot. When I put it in the if statement, it doesn't determine the palindrome correctly. It says everything I entered is a palindrome. Then I try to implement it with the int k, but then it gave me "parse error before +," … |
| | I can't get it to compile. Here are the instructions for the assignment: Write a program that determines which of a company’s four divisions (Northeast, Southeast, Northwest, and Southwest) had the greatest sales for a quarter. It should include the following two functions, which are called by main. • double … |
| | Hi all - I need some advice on how to handle multithreading in a GUI. I wrote an application in C# using only the GUI thread (see screenshot) and at times there are "long operations" where the database is being accessed and the right hand pane is being filled with … |
| | I can add a new node if the head is empty, but I can't attach a new node. Instead I get a null pointer error. Can anyone see what I'm doing wrong. I think I've been staring at this for too long. EDIT: Forgot to say I'm adding the Nodes … |
| | Okay i need this quick please i am kind of stuck basically i have got to find the highest and lowest numbers out of four integers. Is there a function in java.math or do i need to make one using a loop maybe? |
| | [B][COLOR="Red"]Can someone please help me to understand how to read and write unicode from/to a file? also how to set and print a variable to/with unicode (like a wchar_t variable or whatever.)? Im at an intermeddiate lvl in C++, and when I search this on google I don't understand a …  |
| | I have the following GUI code but my JLabel for results doesn't work when either of the buttons are pushed [code] import java.awt.*; import java.awt.event.*; import javax.swing.*; public class TempConverterPanel extends JPanel { private JLabel input, results; private JButton output_f, output_c; private JTextField temp, fahrenheit, celsius; public TempConverterPanel() { setLayout … |
| | I have to parse the following file in C and call like specific things like ingridients, time and stuff, so how do I go about storing it in a file. The recipes repeat over and over in same format. ************************ Recipe: "Creamy" Salmon Over Pasta By: Skinny One-Pot Meals, Ruth …  |
| | I need to make this program pass by reference. How can I do that? [CODE] import java.io.*; import java.util.*; public class Convert { static Scanner console = new Scanner(System.in); public static void main(String[] args) { int pounds; int lb; int oz; int totalOz; int lbs; int ozs; int totalOzs; //Calling … |
| | cut a long story short I have 2 tables, one called orders_total and another called orders_complete. the total_oders table contains rows of what the customer has ordered to eat i.e. colum called 'item' contains the item description colum called 'cost' contains the item cost for example i can sucessfully display … |
| | Looking to figure out how to do set an at job up from within a shell script w/o using the -f option. The at -f option provides no method (that I can determine) for passing additional command line parameters to the file. I have explored trying to use stdin redirection … |
| | Hello, I'd like to create a function that accepts two objects and compares properties between them. Example [code=java]public boolean (obj1, obj2){ if obj1.property1 = obj2.property2 return true else return false } [/code] How can I do this? |
| | Greetings: I am chugging thru Boa Help Getting Started Guide for Boa Constructor , Kevin Gill , November 1, 2000 and am at Section: 2.7 Creating a Dialog Window doing everything as specified in Help, Save/Run and click on Help/About , no Dialog comes up. [Frame2.py , App2.py , Dialog2.py] … |
| | Hi all. I am currently developing a CMS for a school project and I wanted to add the function to check, real-time, if a username is already taken. It should be a little bit like what happens when you register for a Gmail or Yahoo! account. Basically, while the user …  |
 | I operate a real estate directory site. [U][B][COLOR="Red"]Trouble of the day:[/COLOR][/B][/U] Cannot get my Back URL to go back to the previous page with all the user' search criteria still there. It goes back to the page and [U]they have to fill their criteria again[/U]. [U][B][COLOR="red"]Example: [/COLOR][/B][/U]They pick Fiji and … |
| | I have set up a guestbook on a flash site and the customer has asked for a bad word filter to be incorporated. I have this code for it: $bad_words = explode('|', 'badword1|badword2|badword3|etc|etc'); foreach ($bad_words as $naughty) { $comments = eregi_replace($naughty, "#!@%*#", $comments); } Where in the following code should … |
| | Hai there, I would like to ask about currency format in Bash script let say i have $US2550000, after format it, it become $US2.550.000,00 Thanks for the help |
| | I am trying to count the number of each letter grade for a list of students and count how many are male and female and how many students there are total. The problematic section is: [code] int ItemType::CountItems(int& ACount, int& BCount, int& CCount, int& DCount, int& FCount, int& MaleCount, int& … |
 | Hi all, Can anybody help me out with the connectionstring for connecting VB6 to a Microsoft SQL Server 2005 Express Edition. I have tried several documented varieties which do not work. My latest attempt was a version from [URL="http://msdn.microsoft.com/en-us/library/bb264566(SQL.90).aspx"]this website[/URL]. I downloaded the application and associated files and changed the … |
 | Hi there I'm curious as to the process that happens when uploading a file. In all cases of file uploads do the files get uploaded to a temporary folder before any execution of code happens? If at all possible could someone provide a link to a page that explains the … |
| | i would like to make a winamp plug-in.can any1 help me to show me the way how to write the code,please?? thanx. |
| | Hi all, I'm a C++ programmer and now about to use Visual C++. May I know the difference in terms of functionalities? will my code written in classic C++ run on Visual C++? thanks. |
| | I'm trying to read in a text file character by character. However, when I try to read it in it using the readChar method in DataInputStream it gives me a IOException. Heres what I have so far [CODE] FileInputStream stream; try { // Open an input stream stream = new … |
 | Hello to all of you! I would really appreciate somebody telling me complete step by step tutorial how to work with MASM (or TASM, but I haven't noticed it's free to download) I've tried myself MASM and TASM (some Telemark assembly, not Borland), but for some reason it won't work, …  |
| | I'm fairly new to making GUI's in tk so I downloaded activestates GUI builder from sourceforge. It has a very straightforward drag and drop interface and is easy to pick up. However I ran into a problem trying to edit the widgets it creates. It makes 2 files, the first … |
| | I have a buffer of chars. I want to display them in a text box as hex. is there a simple way to do this? Thanks. |
| | Hi guys, being a beginner I have some trouble with pointers. I don't know but something about using pointers is just not getting clear to me. My assignment requires that from an array of given values, the user inputs a particular integer whose every occurrence with in the array should … |
| | Almost every site I look on has at least one, and probably more, people who are going to write their own operating system. What's the point? When its finished the chances are nobody is going to use it - probably not even you. I might not mind spending a few … |
| | I ve to Write a Python program that prints a random DNA sequence in Fasta format. That program should ask for the length of the sequence and suggest a reasonable sequence name. The session should look something like: > python randomdna.py Length: 34 >MySequence TGCGCATATTGTCTAACTATGGCTGTGGCCGGA The output must be in … |
The End.