199,114 Archived Topics
Remove Filter  | |
| | Dear Sir/madam, I am working on Solaris 8. dbx is showing memory access error in the following line: [code] template<class keyType_t, class dataType_t> int WrapperC<keyType_t, dataType_t>::insert(keyType_t keyVal, dataType_t& info_t ) { pair<map<keyType_t,dataType_t>::iterator,bool> retItor; retItor = subsInfoMap_obj.insert( pair<keyType_t, dataType_t>(keyVal, info_t ) ); ........ }; WrapperC class is derived from an abstract …  |
| | hello, i was looking at a program someone wrote. I saw something like that: name = (char*) strdup(path); strdup already returns char *, so why do we need casting here? did he do a wrong thing or am i wrong? |
| | Here i am posting again the program for creating the table of contents which are filled according to the user with dynamic arrays but yet the problem regarding the output is not solved ,i know dry run is correct , compilation is free from errors and warnings,builtable() function is working … |
| | Hello, I am using spaw editor.Till now i think it is the one of the best editor.But i m now facing 1 problem.Suppose we left editor as empty.then switch tab to html view.then we see a <br /> tag by default.So is there any way to remove this <br /> … |
| | i have a problem. i have a folder named jadu, there are various images . i want to show them in the a page. what i did its here [code=php]<? $path = "images"; $dir_handle = @opendir($path) or die("Unable to open $path"); echo "Directory Listing of $path<br/>"; while($file = readdir($dir_handle)) { …  |
| | Hello Everyone, i have made programs of exceptional handling in cpp, but i am not able to run them in Turbo c, what i have to do to run them plz. explain. thanks |
| | I have an enquiry concerning office 2007 automation on windows 2008 64bit. Basically the issue is as follows: ยท I'm using office 2007 automation on windows 2008 64bit, my solution is using excel office automation (Excel interop assemblies) from a .Net managed DLL to export reports in excel format from … |
| | Basically I'm trying to run a simulation of neurons and this is the code that gets run in the main loop of it. [code=c++] class Neuron { private: double v, u, a, b, c, d, current, du, dv; public: double x; vector<double> pre; int id; vector<int> fired; vector<int*> post; vector<double … |
| | i wrote a code for download image from the website using URL class in java.The code is working fine.But the problem is after some time it shows- java.net.ConnectException:Connection timed out .Here i didnt use any proxy server and firewall.some sites gave soln as like change proxy settings or it is … |
| | Hi friends, I want to copy few cells of an excel sheet and paste special(picture) in ms-word. I want to develop a vb code code for this. Please help!... Regards, Dinil |
 | <<snip>> Original article can be found: here: [URL="http://www.geocities.ws/jeff_louie/safearray.html"]http://www.geocities.ws/jeff_louie/safearray.html[/URL] |
| | Hey guys, I'm making a platform game similar to Super Mario in Pygame and I want to add platforms i.e. I have a background picture that has platforms drawn on it. I then want to make it so he can only go down as far as the platform, and as … |
| | hi, there , i am coming up with a login page and i am having error when i run the programme. It says [B][ICODE]'Invalid attempt to read when no data is present'.[/ICODE][/B] [B][COLOR="Green"]Session("ses_uname") = rdr("FirstName") + " " + rdr("LastName")[/COLOR][/B] [ICODE]Imports System.Data.Sql Imports System.Data.SqlClient Imports System.Web Partial Class _Default Inherits … |
| | nw i hv been tryin a stuff tht m really nt sure if u guys understnd at once..bt sum1 hs to find a solution for it plzzzzzzzzzz... i need a code in C++ to do the following tasks...:- 1.) copy files from a folder 2.) save them in a different … |
| | I wrote a code to get factorial for a number uptil 100. The problem i have is that i have to display the array it is sstored in a single output. So i cant use for statement and print each element. [CODE=CPP]#include<iostream> #include<cstdio> using namespace std; int main() { int …  |
| | import javax.swing.*; class Customer { int id,rate,pre,cur; String name,sex; String read(String n) { return JOptionPane.showInputDialog(n); } int readInt(String n) { return Integer.parseInt(read(n)); } void out(String n) { JOptionPane.showMessageDialog(null,n); } public Customer() { id=1; name="Visal"; sex="Male"; pre=13214; cur=13362; rate=720; } int consumption(int pre,int cur) { return(cur-pre); } int payment(int rate) { …  |
| | so completely new at this. long story short, recently started a new business, have several websites up and running so far, no problems. most of the sites are variations of one site i had built. did the changes myself in Dreamweaver cs4, everything worked fine. tried to do another yesterday … |
| | guys... im on a program now.. i have this prob... that when u inter a number a asterisk would be the out put in a form of a trapezoid... - i got stuck hir guys... #include<iostream> using namespace std; int main(){ int VALUE=0; cout<<"inter VALUE: "; cin>>VALUE; cin.ignore(); for(int i …  |
| | Hi guys, i'm new here and new to c/c++ programming. could you guys guide me how to extract some character/number from a char string? Example: char = TAGNAME_C123_V45_S67_M89 i want to extract the numerical number next to the character. The TAGNAME and the number is varies. So my code should … |
| | I recently downloaded the Eclipse(Ganymede) EE editor.I also downloaded the web application server community(WASCE 2.1) edition from IBM. I started off with a simple HelloWorld web application.i just displayed the msg in the default index.jsp page. When I deploy the application on the WASCE server the web browser is showing …  |
| | ;A program to display the message, "ASSEMBLY LANGUAGE PROGRAM" on the screen. ;MODEL MEDIUM ;STACK Datasg SEGMENT; Beginning of data segment message DB "ASSEMBLY LANGUAGE PROGRAMMING" Datasg ENDs; End of data segment Dispsg SEGMENT; Beginning of code segment ASSUME CS:Dispsg, DS:Datasg ORG 100h john: MOV AH,09h; 9 is function value … |
| | Hello. I've been using a very helpful AJAX-based script called [URL="http://www.gayadesign.com/diy/ajaxtwits-load-tweets-on-your-website-with-ajax/"]AJAXTwits[/URL] to load multiple Twitter timelines for a sports team into a div. The nice thing about the script is that it (1) combines multiple timelines into one chronological timeline and (2) caches the xml for faster loading. Every so … |
| | Hello I believe that VS 97 is a very good tool for programmers and i m looking over it 2years now.I had a copy but unfortunately the cd after some years is unreadable and i cant work.Guys. I need this tool and i can not find it on internet.If any1 …  |
| | Hello Everyone! This is my first actual post although I've been a member for almost a year. I'm writing a program that will create a random number between 1-1000 and ask the user to guess the random number. I also have the program display an error message to tell the … |
| | Hi. I have a Vector of Vectors that I need to rotate 90 degrees clockwise and 90 degrees counter-clockwise. I got it to rotate Clockwise, but whatever I try, I can't get it to rotate counter clock-wise. The 2D Vector is not always going to be a square. It will … |
| | I'm currently taking a introduction course to C++ and I've been able to do the first 3 assignments without much problems, but this new assignment is kicking my butt. The goal of this program was to make a simple text editing program. I simply open a saved text document and … |
| | Hi everyone, I've never had to do this before sooo, I need help. I have a table which maps managers to regular employees. So you could say that Manager A is mapped to 20 peeople and Manager B is mapped to 5, and so on. So the table looks like …  |
| | Greetings all How can i create an executable in run-time? (win32). i need a simple wrapper for different console commands. this is because i must have executable there is no way around it. so what i have come up with is passing the command that i want executed as a … |
 | Hi All, I am trying to display the content of a single row from MySql with the following code but the echo is displaying nothing at all. Please can you advise as to where i can find the error? I have a feeling its something to do with the loop, … |
 | I have posted this thread in the microsoft software forum as well but with no luck. If anyone can tell me how I can save a active excel file using a macro to save it in a folder using the current date as the file name. I hope that was … |
| | I have a wizard control. On one of its pages I have various controls like textboxes and checkboxes. Could anybody please tell me how I can check from my code (e.g. on Cancel) if the contents of the controls has been changed? I know how to check if each control … |
| | Hi! I am trying to design and build a plugin-system to a project of mine. The basic design is to use DLL's for each plugin. Each plugin have a special function that loads all of its functions as macros to the main engine, which has been passed as a pointer … |
| | on line 53 it says menu is undeclared. but if i bought menu first then mcdonalds is undeclared. does anyone know how i can sort this out? ty [CODE] #include <iostream> using namespace std; double money = 50.00; void Mcdonalds() { cout << "Welcome\n"; cout << "How can i help … |
| | Hi, I know the return value of generic search algorithm "find()" is of iterator type. Now how can I output the return value as numeric type? For example: [CODE] short myArray[4] = {2,1,3,7}; vector<short>mVec(myArray,myArray+4); vector<short>::iterator found; found = find(mVec.begin(),mVec.end(),2); [/CODE] In this code the variable found will be assigned the … |
| | I am attempting to see have much run time a program takes, and eventually check the runtime of different pieces of the program. (As it runs it seems to get slower and slower without explanation) Anyways, I tried the sample code posted on a super simple program. If I wanted … |
| | Hello everyone, My file has lines like: >9|102396631|genome..... CCACTTTCTCTCCGCGCTGGGTTGAACATGGTACATCAGACTCCCTGAATCTGTCAGATC TCTTGGTTGCTGTTGACAACTAAGACTTCGGAGCCTGGAG_GATTTGTTGAGGGGGAGCA GTTCTGGGTGTCCTCTGCTGTGACTGGGCTCCCGGCCTCTTGATAATGCGCAACAGCTGC GGTAGAACATCTCATTCCCAG >9|102362951|ENSRNOS.... I want to delete blank lines from this file please help me... Thanks |
 | Hello, everyone! I have a problem with memory free. Here is the necessary code to understand the problem: [CODE] void fillArray(char** referenceArray, FILE* grid) { //Chaรฎne qui va contenir une ligne du fichier. char* lineContent = malloc((width + 1) * sizeof(char)); //Pour contenir le "\0" int i, j; for (i … |
| | Hi everybody, I am having some problems with a multi-threaded application I am developing. I get segmentation faults in different places, always related to std::string, using g++4.3.2 on Ubuntu 8.10 server. Here is an example: [icode] #0 0xb7e18bb6 in memcpy () from /lib/tls/i686/cmov/libc.so.6 (gdb) up #1 0xa8eb1014 in ?? () … |
| | I have a form that I want to edit the values from the database. I am able to update all my values except for the radio boxes populated from my database. After my UPDATE command, the value being grabbed is the initial checked value from the database. [code=php]<?php $db_maritalstatus = … |
| | well i have (not precisely) created a form which accepts manily 1.name 2.subject 3.Message well i have written the php code for that ,well the data sent by the user is supposed to come to my mail id since i am getting the message fail error i have , i … |
| | Hello all, I have to write a program that calculate a bmi of person whose weight is 170 pounds (it increases by 1 pound for each month for 12 months) and 70 inches, after I have all the bmi for each weight from 170 - 182 pounds, under each weight … |
| | [code] i read that a method that is is using throws clause must be mentioned in the try and catch block.So when we use "throws IOException" in the following program why dont we use try and catch import java.io.*; class testthrows { public static void main(String args[]) //throws IOException { … |
| | anybody help me!! i have one tombol that tombol will be used to evaluate the explain!! i have some question with answer choise(a,b or c) with that tombol i want know if my answer true or false!thanks can you show me with a simple database and last question from me …  |
| | Hi, I am trying to write some code to insert coordinates which are taken from the mouseClick position and then added to a 2D array. The user should click 6 positions on a panel and these positions should be stored in a 2D array. I hope you can help. Thank … |
| | How do I import a variable from another function in the same class [code=Python] class W(object): #my class def variable(self): #one of my functions f = 5 def printf(self): #what do i put here to import f from the function variable... #I'm currently working with python 3.1. #I know its … |
| | Hi Guys, I have written a windows c# service that basically write out some text to a file in the onStart function. The program works fine when i manually start or stop it. Now if i leave it started and restart my system, the service does not seem to do … |
| | In my webpage I'm using the PHP function mysql_fetch_array to check if records are successfully retrieved from the database. If records are returned then I can assign variables with the database fields... [code=php] $checkdb = mysql_query("SELECT * FROM products"); if ($info = mysql_fetch_array( $checkdb )) { $productName = $info['ProductName']; } … |
| | im trying to draw a curved line using mouse. there are three points on a straight line. a starting point, an ending point and a point in between. i want to draw a curved line by dragging the middle point in any direction. the other two points remain constant. |
| | I'm toying around with taking variables that are passed from a form, into a new page, but only showing specific portions of the site if the variables come out to having a value. right now im using [CODE=php] if ($seasons=='true') { include('includes/seasons.php'); /* seasons show */ } else { include('includes/products.php'); … |
 | I am using the following code in .y .htaccess file but it is not working <IfModule mod_rewrite.c> Options +FollowSymlinks RewriteEngine on RewriteRule ^(.*)\.htm$ $1.php [nc] </IfModule> Please help me thanks |
The End.