4,919 Topics
 | |
| | Hey, I'm in the process of writing an email header analyzer in C# and i'm stuck on something. Before i go into the problem i think i should write an intro on what i'm looking to achieve. I basically want a program that can read through headers and copy some …  |
| | [CODE]from Tkinter import * import random weapons = ("rock", "paper", "scissors") class Application(Frame): def __init__(self, master): Frame.__init__(self, master) self.grid() self.create_widgets() def create_widgets(self): Label(self, text = "Choose your weapon!\n" ).grid(row = 0, column = 0, sticky = W) Label(self, text = "Weapons:" ).grid(row = 1, column = 0, sticky = W) …  |
| | Hi i have been trying to get a GUI in BlueJ working properly but i hav come across a prolem, i hav 2 buttons which i want to use but when i click them the actionListener wont run my methods. In the action preformed bit i tried to make it … |
| | In here: [url]http://java.sun.com/docs/books/tutorial/uiswing/components/toplevel.html#general[/url] It says: The default content pane is a simple intermediate container that inherits from JComponent, and that uses a BorderLayout as its layout manager. In here: [url]http://java.sun.com/docs/books/tutorial/uiswing/components/jcomponent.html[/url] It says: The JComponent class extends the Container class, which itself extends Component. This is contradictory, isn't it? Also what … |
| | Hi, I've made a small program which has 2 buttons and each does certain thing. Here's a simplified version of the code. Thing is it works fine except that the button freezes and stays in a clicked position and whole GUI freezes until the command is completed. As far as … |
| | I am trying to read a textfield. I am using the string=textfield.getText() notion, but all I get a is a blank string back. I am using netbeans and I am using the gui designer within it. I want to hit the "create grid" button and have it create a grid … |
| | I have read quite a bit on this topic and am pretty sure that the correct method would be to use invoke, but I can't wrap my mind around how to call it (been working with c# for about a week). I have a HandleCommand method in the MainForm class … |
| | Hey, I am trying to use Tkinter to provide a gui to a simple python script. No matter what I try, my tkinter window always ends up maximised, filling the entire screen. Specifying the height and width has no effect. I have tried a simple label, and tried putting the …  |
| | Hi, I'm writing a GUI app with wxPython and I am wondering how I would insert and read/parse accented letters (Spanish accents, for that matter) from a TextCtrl widget. Also, I would like this would be compatible with all platforms (Windows, Linux, etc.). How could I do this? Thanks very … |
| | Hi all, I have a WinServer 2008 machine. Currently, I can connect remotely with only two local users concurrently. I want to set this number to a greater one. * how do I do it using windows GUI? *Does someone knows what attribute or term I should google inorder to … |
| | Hi, I'm writing a multi-threaded script with wxPython as a GUI toolkit. About 50% of the time, I can run my script flawlessly. The other 50% of the time, I get [U]huge[/U] errors regarding wxPython that I cannot seem to decipher; however, I think it could possibly be a problem … |
| | Ok, lets see if I can expain better, unfortunately I am somewhat of a beginner. I am using Microsoft office access 2007, using Microsoft Vista, and visual studio 2008. I am writting a program that uses a GUI to show and change a Access data base. When I first tried … |
| | Short version: How can I provide a GUI over the web to a user to allow them to select a file from a directory on the server? Explanation: I need to process data files stored on the server and generate some graphs of the results. I have (as my first … |
| | The code for sleeping barber problem. When the status of the barber is set to busy then the customer cannot have a hair cut and is added to the waiting queue. when the customer is set to free then the customer have a hair cut. Here the problem is that … |
| | Ok, using Jgrasp I was given a problem that asked me to design a GUI program to find the weighted average of four test scores. The four test scores and their respective weights are give in the following format....testscore1 weight1 This is what I have so far, the code will … |
| | hi, i´m a student from Costa Rica... and my teacher give us a extra-class work, we need make a graphical interface so if there is someone who can give us a hand with some tutorial or book(PDF) or something like that, we need learn how make a window, a button, …  |
| | Well, I am currently learning Qt and I develop on two systems, a Mac OSX 10.5 and Ubuntu. I decided to make a small app with the default template in QtCreator (Qt4 GUI app). I put some menubar entries, and the last entry "Exit" is separated by a separator. While … |
| | Hi All, I am using ImageIcon to display an image, however, the image does not appear. See the code i am using below. Can you see what the problem is? The receivedImage will be taken out of an object it is stored in, and then i want to display it … |
| | I have done a mortgage calculator program. it builds and run but I think tje GUI must be wrong because I cannot see it. I am very new to this and I am so lost. I do not know if this is the right forum. [code]import javax.swing.*; import java.awt.*; import … |
| | Hi, I'm creating a Java Swing application that lets the user enter the usual details one would expect in an address book then click the save button. The current JPanel will then be hidden while another JPanel is shown. This second panel is used for viewing all the contacts added … |
| | Hey all. Ok i've written the code below with no syntax errors. However, im struggling. 1) For Button 1 - Check Balance, I want to firstly bar out the pin number so it doesn't show. How do I do this? 2) For button 1 - I have added show input … |
 | So I'm on my dad's computer and it runs real slow so I tried running a few different softwares on it. First time I've ever used Hijack-this so if you could tell me what I could do with this log I would truly appreciate it. Logfile of Trend Micro HijackThis … |
| | Hey all, i'm looking for some help/advise on how to tackel a piece of code i'm stumped on. My project is in netbeans, GUI swing, JForm. Ive made up all my gui appearance, i have a jtext box that shows the calculations of 3 other jtext boxes from a user's …  |
| | Hi i need an event handler method to let an user use the 4 arrow keys (up,down,left,right) from a keyboard input ... and also the letters "Y" for yes and "N" for no on the keyboard. [code]import java.io.IOException; import java.util.logging.Level; import java.util.logging.Logger; //group Albers, Rodriguez, Gonzalez, Leys, Larson, and Aponte …  |
| | I am very new to c# so please bear with me. My goal is to make a simple tcp chat server and client to get used to c# sockets a bit more. I do have experience with sockets so I thought this was a good place to start. The code … |
| | I'm currently working on a small text game project as an exercise in Java. Just recently, I've come to a point where I am having difficulty with the logic behind the flow of the program. It had started out as a console application with a very sequential series of events … |
| | Hello Coders out there... I posted my code for a binary search tree assignment and the code is a working code... :::::DETAILS TO KNOW ABOUT THE CODE:::::: the program is required to 1. ask user the HEIGHT OF THE TREE which will determine the length of the array.. 2.and then … |
| | I have my calculator GUI to display as I want it too. When I put in my mortgage amount and choose an option from the drop down box and hit calculate everything works as it should but when I try to manually put in the terms and interest rate and …  |
| | Hello, all. After trying to wade through a great deal of undocumented and uncommented code in order to speed up a frame capture rate, I've decided that, for my sanity and that of my boss and any coders to follow me, I should start over and write it myself. I … |
| | Hi everyone, I am doing a program here to ask question about alphabet, and i am only in the middle of it and i face some problem that i really cant solve, need some help here... ok the problem is, for(int j =0; j<20;j++), in output, the 1st jlabel.setText(j) is … |
| | I'm new to here.so i posted it on the code thread pls go through it and help me [url]http://www.daniweb.com/code/snippet271890.html[/url] |
 | [code]#Blast workbench using biopython from Bio.Blast import NCBIWWW ##result_handle = NCBIWWW.qblast("blastn", "nr", "8332116") fasta_string = "AATTCAGTGGCAAAAAAAAAACTCAAATTTTAGGGAAGGCCCTAATATTATCAAATAATTAGAGGGGGGG" result_handle = NCBIWWW.qblast("blastn", "nt", fasta_string) save_file = open("my_blast.xml", "w") save_file.write(result_handle.read()) save_file.close() result_handle.close() result_handle = open("my_blast.xml") from Bio.Blast import NCBIXML for record in NCBIXML.parse(open("my_blast.xml")) : #We want to ignore any queries with no search results: … |
| | The application will ask questions like: What comes after D? A child is expected to answer the question and the application will inform the child if the answer is correct or wrong. The application will ask a total of 20 questions. After all 20 questions have been answered, the application …  |
| | here i attached my question ... and i have done the first part and i stuck in the logic part ,can anybody help |
| | This program is a GUI shopping menu with text fileds next to item descriptions. My question is about the add method in ShippingCart class. It is called every time an action occurse in a text field, from a GUI class not shown here, where quantity requests are entered. So when …  |
| | I'm a bio informatics student who is leaning programming.With the help of this site and other blogs I made this one so far.I need to create a interface which give a text box to enter sequence and a start button and a window that display results.I went through Wx tutorials … |
| | Hello, i need assistance with a mortgage calculator program. the requirements are : Program designed with GUI to Write the program in Java (with a graphical user interface) and have it calculate then display the mortgage payment amount from user input of the amount of the mortgage and the user's … |
| | I was wondering if anyone knew of a good library to use for making gui's in c++. You should know that i know of winprog but the problem is that its c. I don't want c because i haven't learned c. I would like to use something that you code … |
| | Hi, I have serial data that can come in at irregular intervals from a hand held barcode scanner. The scanner continuously looks for a barcode (no button or trigger is ever pressed) and when the scanner captures a valid barcode it sends the code to the PC over serial. What … |
| | hiii....i done some graphics programming on a turbo c compiler & i would like to link it to a front end...& may be even develop a gui out of it....please tell me the procedure to link a turbo c code to a front end |
| | I have a program that takes an object, turns it into an array of bytes and then sends it to another program using sockets (a la [url]http://www.java2s.com/Tutorial/CSharp/0580__Network/Catalog0580__Network.htm[/url] Socket Client & Socket Server GUI). My problem is that when the object arrives at the second program, I cannot turn the byte[] … |
| | Just to check with u guys I got a GUI Menu with few selections e.g. "Monkey" , "Elephant", "ViewList", "Exit" . When i click on "Monkey" a JOptionPane Sub-Menu will pop up and i could add or sell . but when i want to go back to the Gui Menu … |
| | Hello all! I'm hoping someone out there has come across this little bugger and can tell me what to do! I'm at the point of having to reinstall my Windows XP as a last resort here, but hope that there may be another solution. Here's the problem. 2 days ago, …  |
| | Hello! I am in the 11th grade and I have started with one of my colleagues to work on a file compression program based on Huffman coding. I have previously worked with python (a program that handles some .xls files) but this project is more complicated so I shall need … |
| | Hi all, i am not an experienced Java GUI programmer and its the first time i'm asking for help in programming on a forum. I have this simple GUI which allows people to mark text with different categories. I use JTextPane and DefaultStyledDocument. Basically, i took most of the code … |
| | i want to develop a c++ program that may take a visual input like a graph and then manipulate it to find whether its a planar graph or not....i am well versed with the algorithm to do this...just want to know that how can I read the input from a … |
| | Hi i was wondering if it was possible, in java, to save a session/state of an application and then reloading the data (all automatically)when re-opening?? I have a GUI with some textarea, a jtree with filesystem hierarchy and a jpanel with buttons. I can create many buttons and within these … |
| | I did a project last year in VB for image processing, basically link to a folder, load an overlay and loop through the folder overlaying a watermark. I now need to get the same thing running in python to cater for cross platform use. I have translated all the image … |
| | Hey, I'm having problems with JTextPane, I have class which has gui and other class for the software logic (in this case text editor), so when I try to save a file using filechooser it works fine to the point where it needs to save the information from the JTextPane, … |
 | Hello guys... I'm trying to develop an application with a GUI that sends and receives data via http, by sending a url via POST and eading the content generated by the url. or instance, if i send a nick and order number, the server generates a SessionID via html. My … |
The End.