199,114 Archived Topics
Remove Filter  | |
 | Help me I have created a dataset. Then created two data tables with dataset.tables[0] as data for first table and dataset.tables[1] as data for second table. then I created parent and child coloumns. then I created parent row. Now how can I need to select childrows from parentrows. Regards jineesh  |
 | I was helping a friend fix some issues with her iPhone connecting to a JavaScript-heavy (and buggy) site. Long story short, her iPhone cannot type brackets ([]), and I need another way of getting the first element in an array. I thought there might be a javascript function like first() …  |
| | hiya, I'm very new to how javascript works and have inherited a website that contains a form that uses the calculate total function...which only works in IE. I've searched all over the net trying to find a solution to get this working across all browsers but not having much luck … |
| | I am working on IEEE Paper "An Architectural Design Selection Tool Based on Design Tactics, Scenarios and Nonfunctional Requirements". I want to know what's the criteria for selecting Relationship between 1. Quality Attributes to Quality Attributes, 2. Quality Attributes to Tactics and 3. Tactics to Architecture Styles. |
| | While I have hundreds of draggables, the performance is very dramatical. So I want to hear from you if its possible to write code around it. Have you devs a solution to create a draggable on the mousedown event? The problem I face now, is: that I can create on … |
| | i want run an applet as an application and i want to run an application as an applet. i know there is a way to do it with only two lines of code i just can't figure it out. do any of you know how to do this? any help … |
| | Hi..I am Fredy I want to access and get record from database mysql online( on internet) using vb.net could u help me how to connection and get record from database online. thanx Fredy ym:zuve_fox@yahoo.com.au |
| | [code=vbnet]Imports MySql.Data.MySqlClient Imports System.Data Imports System.Configuration Public Class frmMasterCode Dim conn As New MySqlConnection Dim myDataAdapter As New MySqlDataAdapter Dim sqlquery As String Dim cmd As New MySqlCommand() Dim myDataReader As MySqlDataReader Private aeps1DataSet As epsDataSet Private amasterCodeTableAdapter As epsDataSetTableAdapters.master_codeTableAdapter Private WithEvents amaster_codeBindingSource As BindingSource Private Sub frmMasterCode_Load(ByVal sender As … |
| | Anyhelp with code below would be greatly appreciated Warning: mysql_result(): supplied argument is not a valid MySQL result resource in /usr/home/rconn/domains/dadpop.net/htdocs/online-bookmarks/register.php on line 44 you have been successfully registered. Read your email and click the link to activate your account. [code=language] <?php require_once ("./header.php"); $secret = "dDWUc72sCcs20cXskcw"; $reg_register = set_post_bool_var … |
| | Hi all, I am fairly new when it comes to SQL... and i would like some help I would like to run 2 select statements in the same time...in order to get my results in a table with 2 columns and 2 rows that shows me the result of my … |
 | im trying to get the username of the personal profile. the url is example.com/theusername/index.php the "theusername" i want to make into a variable. How do i do that? i want the variable to be called "theusername" so how do i make that into a variable? does anyone know? with php … |
| | I need help Im trying to get a form to work with PHP and it doesnt seem to be working. I fill out the form and click submit. It changes to a blank white screen not displaying the thank you page or email the form fields. Any ideas? Thanks [code] … |
| | [B]just a small query... how to get User's login time and logout time...??? as well as how to know whether particular user in Logged in out..?? Thnx[/B] |
| | Greetings, I'm not a very advanced programmer at all. I found a piece of code that helps me out a lot at [url]http://www.codelifter.com/main/javas...lideshow2.html[/url]. It allows an image to crossfade into another, into another, etc. I'd like to be able to crossfade an image, with a text caption underneath it, to … |
| | Ezzaral & James -- I remember (and found) a thread from a while back where you guys gave me an example of an Observer pattern. Basically a model had a List of interested Listeners. When the model changed, it went through a for loop, notifying each listener (the views) that … |
| | so my program has to read data from text file and pass it to the function. text file contains integer and string in every line. it looks like this: 23456 john 96512 martin 56985 wendy i've written it in C using this code: while (fscanf(filestream, "%d%s", &key, &value) == 2){ … |
| | Ok, so this is kind of a complicated question... but... Ok so I have a python script, you enter some numbers it gives you some numbers back that sort of thing. But of course right now it just looks like a black window with text. kind of like [URL="http://blog.benhall.me.uk/images/InstallingWindows2008EnterpriseCoreServe_F3A1/6Cmd.jpg"]this.[/URL] But …  |
| | Hello, I am trying to create a program to stress test a website, I am using a counter on the page to see how many "clicks" have been made to this website. Currently i am using HttpWebRequest to make a connection to the site and then end it. However this … |
| | Hello, I am getting the follwoing error in my program: *** glibc detected *** free(): invalid pointer The program is as follows. [ICODE]int main() { operation1* sjob1 = new operation1(); answer* ans1 = sjob1->execute(); delete sjob1; operation2* sjob2 = new operation2(); answer* ans2 = sjob2->execute(); return 0; }[/ICODE] I have …  |
| | Hey ppl, i am trying to do this exercise from my java book, but i cant do anything right apparently :( [I]Write an application that asks the user to enter an integer n, and then draw an n by n grid on the panel. whenever the user clicks inside one …  |
| | This is part of a connect 4 game. I'm trying to get a picture to move each time a player makes a move by calling paintComponent but java won't let me. How do I move a picture in my code? [code] import javax.swing.*; import java.awt.*; import java.awt.event.*; public class PanelC4 … |
| | hi, i am picking up js for form validation. does anybody know how i can add a little check (a tiny image) to the textbox if the content is passed ... and a cross mark maybe if the textbox content failed. it would be great if someone may just shoot …  |
| | what is mean by delaysigning in assembly..when we use it in c# .net  |
| | I have reduced the problem to the smallest code required to reproduce it. It consists of a menu using an unsorted list <ul> in my MasterPage.master file with some css in the stylesheet.css (there are images referenced in the code, but not required to see the problem). Here is what … |
| | Hello everyone, I hope I have posted this in the correct forum. I have a good knowledge of VB.Net and VC++ and have now takent he brave step into assembly level programming. I'm starting out with just a bit of inline assembly in a c++ program and toying around with …  |
| | In one View, I have text boxes and buttons. In the other View, I have a Pie Graph that I created using JFreeChart. When the button is clicked, I want the Pie Graph to be refreshed, displaying the new percentages (based on what the user entered in the text boxes). … |
| | Hi everyone! I'm writing trojan/virus for educational purposes only. That is my final practical work. The problem is that i need to fire up a .vbs file from disk.To do that i need path. How to find path and save it to string variable. Even bigger problem is how to … |
| | Hi I am making a rock, paper scissors game for fun & for practice. My problem is; I am trying to create a string by adding 2 character variables together. How do I do this? Do I use the insert function? Or something I think is called crstrt or something … |
 | Hi, to answer this question you need to have some experience about php... i'm planning to create a http server that supports cgi. Does anyone see the problem in C++ -source? Php doesn't give any output, but if I don't set the rfc3875 environment variables, all output comes normally (expect …  |
| | I have a site with SSL and am getting some very strange behavior when trying to go from https to http. In its most basic form, the problem is if I redirect from an https page to a different fully-qualified url such as [url]http://domain.com/sample.aspx[/url], the redirect actually goes to [url]https://domain.com/sample.aspx[/url]. … |
| | hai i am new to sas.i want to do base sas certification can anyone provide me the material and what is exam code for base sas certification. |
| | Hi I made a code where user can guess the number. Now I would like to implement the number of tries and I would like that the user will only guess til 3 times. It seems I'm quite lost here. I tried to declare it as constructors but not sure … |
| | Hi, I am looking to create a C# application that when ran remains inactive (and hidden) untill I hang the mouse over something.. such as the 'My Computer' icon on my desktop (it will then display a message). Is this possible? If so, can anyone point me in the right …  |
 | Hi All, I was trying to research my problem, but wasn't getting any results to satisfy me. The problem is: I am storing data in a mysql database (the server time is stored as well), I am also uploading data into this database from a file that was downloaded from … |
| | I need to take a text file of a number of gene sequences in fasta format eg >geneA agctactactacgatcgaacgtagctactactacgatcgaacgtagctactactacgatc gaacgtagctactactacgatcgaacgtagctactactacgatcgaacgtagctactact acgatcgaacgtagctactactacgatcgaacgtagctactactacgatcgaacgtagct actactacgatcgaacgtagctactactacgatcgaacgtagctactactacgatcgaac gtagctactactacgatcgaacgtactacgatcgaacgta and put it into: geneA agctactactacgatcgaacgtagctactactacgatcgaacgtagctac where all of the sequence is on one line. I can concatenate it in excel for one sequence but i have … |
| | I would like some help with a small issue... I have an html menu that I use on all my web pages, hence it is in my masterpage.master web page. The problem is that when a user clicks a menu choice I need to inject id="current" into the <LI> element... … |
| | I have been working on an assignment for a while now and I have had many problems making the program work from the information and help supplied by my course. The program I need to make is one that analyses text files to obtain statistics on their content. The following … |
| | I am writing a simple program for managing the final grades of students. The program first read original data from a file called "final.txt", and create a linked list to store the imfornation in memory. The format of the orginal data is "Class_Character Seat_number Computer_grades Laboratory_grades". There is only data … |
| | i couldnt manage to change system.windows.forms.listbox item color, do you know how to do that? thanks. |
| | Hi , Can ne1 tell me how 2 write a c++ program to find out the determinant of a (mxn ) matrix (need not to be square ).. If possible give me the code ,of some link whr I can find it ...  |
 | Hi, I have never been into sockets, so I decided to dive in. With some help from devshed, I managed to make a server as shown below. But I cant get it receive data from client. Please correct me :) ERROR: socket.error: (10057, 'Socket is not connected') [CODE=python] import socket … |
| | could u pls help me out to create one databse inside another databse using PHP , MySQL. is it possible?? |
| | Hey everyone, I'm relatively new to C++, cant seem to find a solution to my problem. I'm trying to randomly generate an array of class objects. I'm using rand() to generate a number 1-3, for the number of objects to generate. For some reason when I use: [code] int c_gen … |
| | Hi all I previously developed in Access and have recently decided to move over to SQL server back-end and vb2008 front-end. My Everest of problems which I can’t solve is the how to filter records by a user selected parameter. However, if the parameter is null then all records should …  |
 | I recently updated our servers to CF 8.0.1 and now none of my AJAX code works. I checked the XHR response in Firebug and instead of returning the requested data, it returns the HTML code for my site's home page. All of this was working before the update and I … |
| | Hello people. I seem to connect and select the data i want from a specific and big table. But when the information to be selected is small, everything is allright. But when i try to select information that is not that much small. For example when i select from 3000 … |
| | Using vbscript I want to create a runtime html login page on the fly. The html page should have username/pasword form and I will use this username/password to connect to a sql database. Is there a way to create this runtimehtml page using vbscript and them collect the username/password from … |
| | Hi I'm designing a code where one can guess the Magic Number. In my code I have this part here where I declared the randomNumber after the class Form1. (the green mark below). Can somebody tell me what's the name of this part here? Is it static variable? And what … |
| | write an application that finds the smallest and average of twenty floating point numbers entered by the user.Use a for loop to capture the user input and store the numbers in an array. display the smallest number and the average of the numbers entered i urgently write this program can …  |
| | Hey everybody, i am writing a "database based" application. i organized my GUI with different frame- and panelobjects, which need database information (connection, uernames etc). is it possible, to define those information in an external files and just import these data (like in php)? i tried a solution with an … |
The End.