2,977 Topics
 | |
 | Not sure if this can be done. There are word files in a directory with all familiar names. i.e. fr001, fr002, fr003, etc... all with the extension .doc. I would like to know is there a code that will link an excel file to a directory and then be able … |
| | Hi, Anyone here know how to compare the old array data from database with the new array data also from the same databse? Please help me. Its urgent.. :( |
| | Im trying to get my program to look like the following Welcome to the 64th Primetime Emmy Awards! ============================================================================== The nominees for Outstanding Comedy Series are: [1] Write In [2] The Big Bang Theory, CBS [3] Curb Your Enthusiasm, HBO [4] Girls, HBO [5] 30 Rock, NBC [6] Veep, HBO … |
 | Recently bought "Regular Expressions Cookbook 2nd ed." and wanted to share my findings. The book is divided into two parts. The first part (3 chapters) describes tools, skills and programming. The tools chapter shows you what's out there (including his own software). The skills chapter is a tutorial. It describes … |
| | Hey Guys So in my work, I create an excel spreadsheet. The spreadsheet has cells with hyperlinks in them. When clicked on, the user is taken to another cell within the spreadsheet. Sort of like an anchor. So I was reading on the web that there are no free PDF … |
 | Hello hi. I am seeing flames with using FILESTREAM in SQL Server 2008! I have a table (Products), in which I wanna store a link to an image stored on disk, under the ProdPicture column. This is what the script looks like: CREATE TABLE PRODUCTS ( ProdID INT PRIMARY KEY, …  |
| | I have installed Qt on my ubuntu laptop and I get nothing but errors compiling .cpp files with <QApplication> preprocessor directives. I am new to using Qt and are reading a book online about it hosted here: http://www.informit.com/articles/article.aspx?p=1405562 Specific error i have obtained running g++ hello.cpp -o hello: hello.cpp:1:24: fatal …  |
| | Hi! Just joined up here learning about Android programming. I've been programming since 1980 (COBOL, Fortran IV, and some Apple II BASIC!) and try to keep up with the tech curves, though it ain't easy. These days I'm programming in PHP, perl, and Java. I also do raytracing with POV-Ray …  |
| | Hi, I have a file containing multiple-headed data (input file 1), and also a second file containing elements for searching the first file. input file 1: UROPA sseD 1.2.3.3.3 crimson ddsU 2.1.4.1.2 green SAMEL aadH 7.4.1.1.1 blue uuoG 10.1.2.3.4 white MOONA gmaL 3.4.1.6.7 red oolJ 9.1.1.4.1 yellow input file 2: … |
| | Hi, I need to search a particular string in a CSV file ("STPSTR01.134") the line that contains this string. I need to divide the 13th column by the 14th column. Any help would be very much appreciated. I'm using ActivePerl for windows /csv file allAssociationUtilizationData;V16SG;2012/07/27;10:45:00;STPSTR01.134;900;FALSE;SCANNER;10;3471;6288;11093;10419;588480;631296;0;254004;316732;0 allAssociationUtilizationData;V16SG;2012/07/27;10:45:00;STPSTR01.58;900;FALSE;SCANNER;10;20652;23514;39497;29404;4690132;3929776;0;3471992;2947904;0 allAssociationUtilizationData;V16SG;2012/07/27;10:45:00;STPSTR01.60;900;FALSE;SCANNER;10;20593;19351;36274;26039;4350820;3462084;0;3234956;2593056;0 allAssociationUtilizationData;V16SG;2012/07/27;10:45:00;STPSTR01.62;900;FALSE;SCANNER;10;24237;21229;40003;28678;5122408;3703840;0;3875508;2746088;0 allAssociationUtilizationData;V16SG;2012/07/27;10:45:00;STPSTR01.26;900;FALSE;SCANNER;10;18538;20644;35833;26421;4075280;3588768;0;2979124;2707892;0 |
 | Hello, I'm starting to delve into the world of Web Development after failing to design websites at a good standard. I've had a look through the forums but I haven't found a specific answer(s) to my key problems. So if you don't mind, I will list all of my questions/dilemmas … |
| | Hi, I've got a set of folders with each contain many files. I need to extract a specific file extention(.sof) from each of these folders to a new directory(or the same directory in a new folder). Any help is appreciated. Thanks. |
 | Hello, I am receiving this error while trying to save information in admin page: http://localhost/RustoleumCustomCMS/administrator/%3Cbr%20/%3E%3Cb%3ENotice%3C/Masterlink/cgoods/PHP_SELF%20in%20%3Cb%3EC:%5Cxampp%5Chtdocs%5CRustoleumCustomCMS%5Cadministrator%5Cinput_berita_static.php%3C/b%3E%20on%20line%20%3Cb%3E174%3C/b%3E%3Cbr%20/%3E Object not found! The requested URL was not found on this server. The link on the referring page seems to be wrong or outdated. Please inform the author of that page about the error. If … |
 | I am going to work on building a database application. One part of this is parsing pdf files which will feed the data into the database. Will be using SQLite build it C which has wrappers for Perl so there's not problem there. From what I understand, Perl is a … |
 | I am trying to send sms through Way2sms using Perl LWP. The login part is being successful, after which I save the cookies to a local file. The welcome page after being logged in shows a Send SMS link, clicking on which one is redirected to another page with two … |
| | I need help in using a variable passed in a hyperlink query string to do PHP query of a MySQL database. I want use the variable to query the database and return the unique row field data to display in a table The hyperlink is: [CODE]http://www.site.com/bios.php?pc=ab [/CODE] After connecting to … |
| | I am trying to write a script to grab images from my CCD camera. I can already do this with C++ usung VFW and OpenGL, but I want to find a way to do it with Perl. It needs to be able to run on windows though. I am pretty … |
| | I am trying to pipe username and password (not to pass through command line for safety purposes) from one python script to another python script with some arguments. I was successful in perl implementing the above like this program - perl1: open(INPUT,"|perl my.pl $arg1 $arg2") or die "cant fork $!"; … |
| | I am having two file (File A and File B) of sequence. In File A, thousand of sequences are in fasta format (For example:>seq1 GGTGTTTGCGTGGTTTCATGAAGGTTTTACTaTCCCGAGGAGCCTCATTAAATTGGCAAGA CTCATTAAATTGGCAAGAGGTGTTTGCGTGGTTTTGGCAAGAGGTGTTTGCGGGTTTTAAA >seq2 CTCATTAAATTGGCAAGAGGTGTTTGCGTGGTTTTGGCAAGAGGTGTTTGCGGGTTTTAAA TTTGCGTGGTTTCATGAAGGTTTTACTaTCCCGAGGAGCCTCATTAAATTGGCAAAAAAAA In File B, Two differnt things are avilable first is the sequence number i.e. >seq1 and its position number 10-120 similarly …  |
 | Hi Daniweb, I've been using perl for Regex recently and I want to know is it possible to create an Excel Movie Library with the movie poster, the name of that file and a hyperlink of that clip is attached to the poster. Any help is appreciated. thanks. |
| | I recently came across this code on the internet and I'm having a very hard time understand how it works. I was hoping someone could comment the code a bit in order to help me learn it better? I understand most of it, but get lost when any of the … |
| | Hello I am trying to run a perl script on tomcat server. I am putting the incoming http request in a variable data which collects the headers as well as the text file attachment data. The code is like this : .... while(<>){ $data = $data . $_ ; } … |
 | I've attached my output error and my script is below, also the link the the directions. http://www.linuxfromscratch.org/lfs/view/stable/chapter05/perl.html Here's my script: ( patch -Np1 -i ../../../perl-5.14.2-libc-1.patch 2>&2 | tee patch-perl.log && exit $PIPESTATUS ) && sh Configure -des -Dprefix=/tools && cp -v perl cpan/podlators/pod2man /tools/bin && mkdir -pv /tools/lib/perl5/5.14.2 && cp … |
| | Hi, I am trying to search for a line in a file, comment that line using a " * " and finally append the range of corresponding lines extracted from the same file. The corresponding extracted range of lines maybe present before or after the line (which is to be … |
| | Im from Chennai, India. And my university is Anna University. Our results are published in their website and in couple of others. Our college staff go into each url for each student and copy marks and do analysis stuff. Im working on a project to help them do it automatically. … |
| | Hi, Can anyone help me in calculating the number of day between two date with this date format, YYYY-MM-DD? I am using Date::Calc qw(Add_Delta_days) but still cannot read. I got this error : -> <?xml version="1.0" encoding="UTF-8"?><soap:Envelope xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:soapenc="http://schemas.xmlsoap.org/soap/encoding/" xmlns:xsd="http://www.w3.org/2001/XMLSchema" soap:encodingStyle="http://schemas.xmlsoap.org/soap/encoding/" xmlns:soap="http://schemas.xmlsoap.org/soap/envelope/"><soap:Body><soap:Fault><faultcode>soap:Server</faultcode><faultstring>Usage: Date::Calc::Add_Delta_Days(year, month, day, Dd) at TARGETWEBSVC.pm line 357. … |
| | Hi, I developed a website with PHP version 5.1.4 and MySQL - 5.0.22. I tested the web on my localhost and it worked perfectly well. However, when I uploaded the website, I could not have access to all have to all the data inserted in my database. I could not … |
| | that well known ajax code to filter gridview with text box control on key up event is working fine in fire fox but works only twice and then stops in internet explorer; if i take the grid out of the update panel it works fine on iexplorer also! any idea? |
| | hello all, i have a website like forum not exactly forum but similar. honestly, i bought it cos i didnt have any idea for php. but something about linking is not as i want. for example: when i link some webpage it shows the link [Click Here](http://www.aaa.com) but i want … |
| | Hi Everyone, I need a perl script to create a word document in linux (in my system i have openoffice(oowriter) 1.1.5) with some text as header(left aligned) which is taken from a "file.txt". contents of the file.txt are HariKrishna 1200 Srikanth 1201 Madhav 2345 So based upon the no of … |
| | Hi, I'd like to create a perl script that takes two input files, one being a master list of users/attributes, the other being a newly uploaded list. I'd like two output files, one being a file with new users (not in the master list) as well as updated users (changed … |
| | Hi, suppose I have written a Perl script that creates a text file, writes something to it, and closes it. The code involves some other steps which require the download of a module from CPAN. So I do this prior to executing the code by doing something like **perl -MCPAN … |
| | #!\strawberry\perl\bin print"Enter the number of column\n"; $r=<stdin>; print"\nEnter the numer of row\n"; $c=<stdin>; print"\neNTER THE sEQUENCE FOR THE ROW\n"; $i=0; for($j=1;$j<=$c;$j++) { $a[$i][$j]=<stdin>; } print"\neNTER THE sEQUENCE FOR THE ROW\n"; $j=0; for($i=1;$i<=$r;$i++) { $a[$i][$j]=<stdin>; } $i=0; { for($j=0;$j<=$c;$j++) { chomp $a[$i][$j]; print"\t$a[$i][$j]"; } print"\n"; } for($i=1;$i<=$r;$i++) { $j=0; { chomp … |
 | HI peeps, I have a general question about scripting. what's the best scripting to learn (I would like to learn one language) and do you have any link to any good resource, not just a tutorial but somewhere I can see what scripting can do (sorry I am really new … |
| | Hello, I found a PERL script in my root directory (public_html) and I have no idea who uploaded it and how. I know this itself is a concern to me but what I really need to know is what this script can do in worst case scenario. It was on …  |
| | I have a ListView control on a tab page. The backcolor of the items of the ListView are changed according to certain criteria, but whether or not the backcolor changes appears to be pretty random. The tab page containing the ListView is not the default tab page on application startup. … |
| | I referenced Acrobat.dll in a simple C# Console program, and then wrote a couple of lines of codes to run Acrobat. CAcroApp mApp = new AcroAppClass(); Console.WriteLine("Acrobat is running"); bool bClose = mApp.CloseAllDocs(); bool bExit = mApp.Exit(); However, while CloseAllDocs() return true, Exit() always return false. And accordingly I can … |
| | i having problem saving a txt file and printing it back out , i have the hints of using fgets(v[i],14,infile); and sscanf(v[i],"%d: %s %s,%x"%line_num[i],inst[i],reg[2],reg2[0]); i have no idea on how to imply this correctly can someone show me a correct implemtation of the code so i can move forward to … |
| | source.txt Name|Address Ram|USA Geeta|India I want to read this file into hash or map The coulum headers should be stored as keys, and when i call the key it should say me Ram and whn i call Address as key it should say USA Please let me know how can … |
| | Dear expert - I try to use the code as below to get the website htm source and it works. However, I cannot get the result when I visit the website [url]http://reserve.apple.com/WebObjects/ProductReservation.woa/wa/reserveProduct[/url] by using code as below. But, I can access this page by using browser properly. Would you give … |
| | Hi, Can you please suggest me to how to execute .profile from perl script. I have following unix script steps & just wanted replicate them in perl script to make sure I'm executing .profile. . ~/.profile echo $SHELL |
 | I have a exe file named file.exe When it is run through command line, it takes some data and process it and creates an output file. I want to feed data to file.exe within a perl script and want the output file. Please let me know the commands to do … |
| | I am using the following code to select a date range using 2 inline datepickers. There are two date fields (**div**, with class **dateheader**). When a date is selected, that datepicker slides up. Basically when the date **div** is **clicked**, first it is checked whether the corresponding datepicker is already … |
| | When I use my css inline it works just fine, but when I try to do external, it leaves out the first selector group, whatever it is. Right now its my body, but if I took that out it would leave out whatever took its place as first selector. The …  |
| | Hi I am trying to convert .qual and .fna file to fastq using the script provided here. http://seqanswers.com/forums/showthread.php?t=2775&highlight=fasta+qual+fastq The code is as follows: #!/usr/bin/perl use warnings; use strict; use Data::Dumper; use File::Basename; my $inFasta = $ARGV[0]; my $baseName = basename($inFasta, qw/Reads.fna/); my $inQual = $baseName . "/Users/myfolder/Reads.qual"; my $outFastq = … |
| | I am trying to learn how to fetch hyperlinks using perl for an input list of names with ids. Here is what I have come up with so far. Am I heading in the right direction? Any simple ways to get hyperlinks using perl without the HTML table? #!/usr/bin/perl use … |
| | Hi, I was reading about Python and spotted "it has high signal-to-noise ratio" bit. In general, what does it really mean? I read some stuff about it but no particular explanation for programming. Tahnsk  |
| | Hi, I need help to make a perl program work. I have two files - file 1 and file 2. The contents of File2 is to be searched with the contents of file 1. File2: 2 tab-delimited columns XM:1120002 complex-solution MM:0999111 blue-green solution UX:1020022 activity unknown, (simple/complex?) File1:(one column of … |
| | I just came across this question. All the solutions given are in PERL for this question. I thought I can learn solving this in Python as I could learn many thing by solving this problem. But I am stuck. The question is: You are working at a grocery store which …  |
| | Hello guys, I'm trying to find a way of sending MT messages to subscribers from my perl script. My shortcode is 1111(EXAMPLE), and I have three messages I want to send. Obviously, when a user sends a message to my shortcode, they receive a first response; ButI need them to … |
The End.