1,633 Topics
 | |
| | Hi all, I'm new at programming in Perl script, and I really need help with this: I want to make a Perl script which returns current version of some software installed on the system (for example current version of Macromedia FlashPlayer). The system on which I'm writing the script (and …  |
| | Hi, Full disclosure - I just cut and paste my way through scripting - I don't really know what I'm doing. Some time ago I got help with a little CGI perl script that included a link as a line of code with a variable in the form [ICODE]$page = … |
| | So I'm having a bit of a problem with a CGI script. It runs fine, except for the little problem that param(x) doesn't work at all. It will either crash the program or return an undefined value. [code=perl] #!/usr/bin/perl use warnings; use CGI qw(:standard ); $temp=uc(param('class')); $class=chomp ($temp); $temp=uc(param('type')); $type=chomp … |
| | Hi all, I am new to this perl script. I want to open notepad.exe in perl script in the foreground., i.e if I give the command as system ("c:\\windows\\notepad.exe") , notepad should appear in the foreground. (should not run as a background process). I am using Apache server on windows. … |
| | Hi, The below script works fine for me but with normal login, Actually i need to go with "enable 5" and with password "xxxx" to get the user details. So please any one help is here highly appreciated. Here is my prompt for enable, Pleaes have look on it, ERX02>enable … |
| | I am a newbie in perl and I need to produce a script in perl to work and achieve the following: 1) Look into the file /etc/defaultrouter , and store the value in it 2) If the value is a number, go to LIST and print out the second column … |
| | hi, thanku for your help. I need some more help with the perl scripting. i have to write a script which compares two files. now thw files have the data like File1:- .title 'title:VDDL_switched.meas0' max_rush_current = -5.4316e-02 at = 4.9415e-09 powerup_time_u_switch_ring/u2_hs65_ls_sw3l60 = 6.3951e-09 targ = 6.9051e-09 trig = 5.1000e-10 temper … |
| | so... whatchyallthink? i notice that this forum gets a tiny burst of activity about once a week. before posting this thread, the last couple posts here were made 9 days ago. then the next few were 17 days ago. and this pattern seems to be the same with other multi-language … |
| | hello everyone, can anyone help in writing a perl script which automatically replaces the commands in a file(command file), with the new values. i have written a code but its not working properly. if anyone could help me plz. i am new to this scripting language. thanks in advance. Thanks … |
| | Hey everyone, I'm trying to make a perl script that logs me into my account, and fills this form for me for my job, but i cant get it past a drop down menu, wat a person would manually do is put the mouse over this button, and list would … |
| | Hi all , I have loop and I would like to calculate an expression only when the index is even for($j=0; $j<=100; $j++){ if ( ){ do the expression } } i.e how do I tell perl to do the if statement when $j is an even number? Thanks |
| | HI guys. Jeezz, perl forum is kind of abandoned ;/ Anyway, maybe some one will have an idea. I want to write a selfkilling perl prog :D Ok, i got a simple prog which shows up a simple tk window with some text in it, to go to the next … |
| | #!/usr/bin/perl ########################################################################################## # # # AJAX Cross Domain - ACD # # ---------------------------------------------------------------------------------------# # Full documentation see [url]http://www.ajax-cross-domain.com/[/url] # # ---------------------------------------------------------------------------------------# # Copyright (c) 2007 Bart Van der Donck - [url]http://www.dotinternet.be/[/url] # # ---------------------------------------------------------------------------------------# # For installation procedure, see [url]http://www.ajax-cross-domain.com/#Installation[/url] # # ---------------------------------------------------------------------------------------# # Permission to use, copy, modify, and … |
| | I'm developing this game with sockets, server-client connection!! And the problem is I can't put the game work, so many errors along the program, can anyone help me?! It´s urgent.... |
| | How do you add to a variable that is inside a foreach loop? Everything I try hasnt worked. |
| | Hey guys. Ive got a problem with a simple hello world script. Im a perl beginner so bear with me. Im running mandriva linux if it matters. Also this file is saved under /home/rysin/documents. Code [CODE]#!/usr/bin/perl print "Hello World\n";[/CODE] When I go into the command line and use the perl … |
| | I have [CODE]#!/usr/bin/perl @line = <STDIN>; print @line;[/CODE] and when I hit control D, control c, or even control z it just ends the program. Im on a linux machine. Any help? |
| | Hi, In my case i am updating same SDBM file at the same time by executing multiple programs. In my programs i am using tie function. Here is the code. $db = tie(%FILE_NAMES, 'SDBM_File', $tName, O_RDWR|O_CREAT, 0666) Here i need to put one lock to avoid dead lock situation. Thanks, … |
 | Here's one I haven't been able to find an answer to. I have 4 arrays: @array1, @array2, @array3, @array4. I ran code to compare the values of 2 arrays to see number of values in common: [CODE]use strict; use warnings; my (%union, %intersect); foreach my $e (@array1, @array2) { $union{$e}++ … |
| | This code counts number of characters in a single line how can I make it count(give total X Y Z) it in multiple lines seperated by ">" [CODE]while(<IN>) { chomp; my @line = split(//, $_); if($line[0] eq ">"){print @line;} elsif (($line[0] eq "X"||"Y"||"Z")||($line[0] ne ">")) { my %cnter; foreach my … |
| | Hello i am new in perl scripting.I have to write a script to check for .c file and then go in to the ,c file and find all function and insert line1 after `{` and line2 before `}` or before return( if return is present). Can any1 plz help me … |
| | Hi im new to perl..I normally code java...but the boss got me trying to fix this issue... Anyway,we get a news feed that comes in as an xml file...this feed now requires "basic HTTP authentication"...the old feed didint require this , so there was nothing implemented in the code, ...anyway … |
| | I am very sure the code below can be simplified. The exercise was to take a word list, rearrange each word's letter to be in alpha order (e.g. barter = aberrt). The rearranged letter would be the keys and the word be be assigned to that key. Similar keys could … |
| | Hi guys, i need help extracting e-mail id from the text file can anybody please tell me how can i extract e-mail id and store it in a vaiable using perl regex. (e-mail id is not always bound to end with .com) here is my text file: ****************************************** IQXpert 27(ID) … |
| | have a bit of an issue trying to obtain some data from a csv file using PERL. I can sort the file and remove any duplicates leaving only 4 or 5 rows containing data. My problem is that the data contained in the original file contains a lot more columns … |
 | Can someone please tell me what's wrong with this? [code]my $time = "12/Jan/2008:13:38"; my ($day, $month, $year, $hour, $minute) = $time =~ /(\d+)\/(\w)\/(\d+)\:(\d+)\:(\d+)/;[/code] I've tried a hundred different things including not escaping the colons, putting parenthesis around ($time...[regex]), splitting up the assignments to $day = $1, $month = $2, etc... … |
| | Hello all I have been wrting a blast script which results in the following error: [code] the small rnas:CAGCGATGGGGATCAAGCTC the sequnce thats being worked is CAGCGATGGGGATCAAGCTC [blastall] WARNING: Unable to open TCV-jagger.fna.nin [blastall] WARNING: : Unable to open TCV-jagger.fna.nin ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: blastall call crashed: 256 /usr/bin/blastall -p … |
| | HI I am trying to print a certain number of sequences from a file. So if the sequence is like LKSAJDLSAJDLSAJDLKSJD. then I want to write from 10th character to 20th character. please help. Here is my code [CODE]#!/usr/bin/perl -w use strict; use warnings; my ($fileName, $firstSequence, $lastSequence) = @ARGV; … |
| | Hi I am trying to read two files and then copy their content to a third file while removing duplicates please help [CODE]#!/usr/bin/perl -w { open A,shift; foreach (<A>) {$a{$_}++}; open B,shift; foreach (<B>) {$b{$_}++}; open C,shift foreach(<C>) { print unless $a{$_} print unless $b{$_} } } [/CODE] |
| | I'm helping my dad out with some of his website issues, so any help is appreciated. He is getting an error (and no I don't have the exact text at the moment) that there was a fatal error in charlint.pl The problem apparently started when the site's host updated the … |
The End.