4,124 Topics
 | |
| | [code=asp.net]singlecourse = Session("singlecourse") ename.Text = singlecourse.CourseName Session("testname") = singlecourse.CourseName Seclist = que.GetSection(singlecourse.CourseCode) Qnolist = que.GetQnumber(singlecourse.CourseCode) Session("totsec") = Seclist Session("totqno") = Qnolist Session("queslist") = queslist t1.Text = Profile.Ttime pos = InStr(t1.Text, ":") h1.Value = t1.Text.Substring(0, pos - 1) 'h2.Value = t1.Text.Substring(pos, 2) h2.Value = Right(t1.Text, t1.Text.Length - pos) End If Else … |
| | Hi all, I have a shopping basket feature on my website which saves the product's primary key in the session array called 'cart', each one seperated by a comma, so example: '123,456,789'. Now in order to get each item from my shopping basket to paypal I need to write 2 … |
| | I ve to Write a Python program that prints a random DNA sequence in Fasta format. That program should ask for the length of the sequence and suggest a reasonable sequence name. The session should look something like: > python randomdna.py Length: 34 >MySequence TGCGCATATTGTCTAACTATGGCTGTGGCCGGA The output must be in … |
| | [code=aspnet] private void AddRecordToGrid() { try { datatable dt = new datable(); if (Session["SampleDataTable"] == null) { dt.Columns.Add(new DataColumn("ID", typeof(string))); dt.Columns.Add(new DataColumn("Qtr", typeof(string))); dt.Columns.Add(new DataColumn("Exp", typeof(string))); dt.Columns.Add(new DataColumn("Partner", typeof(string))); dt.Columns.Add(new DataColumn("Net", typeof(string))); dr = dt.NewRow(); } else { dt= (DataTable)Session["SampleDataTable"]; } dr = dt.NewRow(); if (dr.IsNull(0)) { //dr = dt.NewRow(); … |
 | Hello everybody, I'm trying to write a php script to read rss feeds. Since I began, I found it is much harder than I expected, because the xml structures are very different, and they need to be interpreted differently everytime. I'm using [CODE]simplexml_load_file()[/CODE] to read the xml code easily and … |
| | Hello, I'm pretty new to C++ and I've been trying to this program to open a file and check if it exists for the last two hours. It seems like it should be so simple but it keeps eluding me. Here is the code in main that starts to run. … |
| | I need to draw a use case diagram for the following: [LIST=1] [LIST] [/LIST] [/LIST]Each member carries a membership card, which is date stamped every time they attend a training session. Their attendance is also recorded in an attendance ledger. Members pay a small fee for attending any session. [LIST=] … |
| | Hello, How can I get a reference to a session? I have a page, which forms a query string, and in another page I would like to display the attributes of it. I don't want to introduce scriplets, so I am trying to do this in a pure Java file, …  |
| | I'm trying to append the end of the file treatments.txt but am unsure how to use the while loop correctly!! Any suggestions?? I tried boolean with the whiles aswell but can't seem to get it to work either. Like asking do you want to continue adding treatments and if yes … |
| | Help, I'm trying to burn 4.7 GB DVD+R discs using Nero 7.2.0.3, on Windows XP Pro SP2, and I don't want to burn the whole DVD at once, I want to keep adding a few files at a time. The only problem (and it's a big one) is that I …  |
| | Hello, experts! On my machine I have installed Windows Server 2008 DataCenter Without Hyper-V SP1 with TS Session Broker role. On two other machines installed Windows Server 2003 Enterprise SP2 with Terminal Server role. All configured on combined action without using of the NLB. The request to WMI-class Win32_SessionDirectorySession returns … |
 | Hi everyone! I'd like to ask a simple question to which I can't really find a definitive answer. If I condense my code a lot, will this mean an increase in loading times which is significant enough? I like having my code spaced out, readable, but I would also like … |
| | Iam not able to pass a value from servlet to jsp using setAttribute and getAttribute. My test code : Test1.jsp ======= [code] <%@ page language="java" contentType="text/html" %> <html> <head><title>Login Example</title></head> <body> Enter Your Text <hr><p> <form name = login action="../servlet/TestServlet1" method=POST> Your Text : <input type=text name=yourText><br> <input type=submit value=LogIn> … |
| | Hi, I successfully send email with the following code in English. However, if the message and the subject title are in other characters, everything becomes question marks and the subject title says something like ...ANSI...3F=3F=3F... How do I set the character encoding to utf-8, for example? Thanks. I have this … |
| | Here's my scenario Workstation *ironic* it's not really working! But anyway. Workstation = XP service pack 2 Dell GX260 tower. Issue when remoting STart>RuN> 'mstsc' I key in the computer name and click enter and receive the error The remote computer disconnected the session because of an error in the … |
| | I try to retrive the doc file from sqlserver,when i execute the code ask me Do you want to open save file? when i click open button the doc file open with error "System.Byte[]" Dim sql As String Dim strcon As New Configsetting Dim cnn As New OleDb.OleDbConnection(Configsetting.ConnectString) Session("Req_SeCode") = … |
| | Hi! Can you help me with this matter? The client session expired when its system date is advanced than the server. The client can no longer login in the program. This happens in Internet Explorer browser. Thanks in advance!:) |
| | i am trying to set session variable using a form but i ahve never done this before and i am unsure of how this is done. i have had a look at a few examples on line but still i am not clear on how this works. here is what … |
 | Hello, I am used to VB.Net, and I recently starting using ASP.Net 2.0 with VB.Net. What I do not understand is how to keep my variables. Everytime the page goes back to the server I lose information. It gets lost. I've looked everywhere and read a lot of information and … |
 | Hey people, I'm at uni and we have lab sessions for Java. In my lab session I have been given an exercise to complete however I need help because I don't know where to start!! Can anyone help me? If you can I will post back with the task to … |
 | Hello Team: I have users who use Reflection-X (we are on AIX 4.3)when execution our application software. If they do not "back out" of the application (... Select X on the various menu screens...) gracefully, and just "click" on the "RED X", in the upper right hand corner of the … |
| | Please tell me message driven bean can be public or private? also for session bean, it can be public or private? Thanks |
| | Running ubuntu 8.04. I'm using the recent module in two different chains SSH_PROTECT and FTP_PROTECT. What I want is for an ip to be allowed to make a new connection to SSH port 22 once every 60 seconds and FTP port 21 once every 30 seconds. [CODE]iptables -N SSH_PROTECT iptables … |
| | I'm using joomla and sobi2, I don't like the layout and want to create a way for the site visitor to choose a category from the home page which should look like this. [URL="http://www.bidmyneeds.com/index.php?option=com_sobi2&Itemid=28"]http://www.bidmyneeds.com/index.php?option=com_sobi2&Itemid=28[/URL] Then I want them taken to this page. [URL="http://www.bidmyneeds.com/index.php?option=com_sobi2&sobi2Task=search&Itemid=28"]http://www.bidmyneeds.com/index.php?option=com_sobi2&sobi2Task=search&Itemid=28[/URL] Where the select catagory would be already … |
| | Hello, I am new here. I need urgent help so I am sorry if I don`t obey the rules of this coomunity - it`s just because I am new here, nothing else. By the way, If my subject is not for this forum, I will be happy if you can … |
| | I`M CREATING A PHP SITE,AND THERE IS A MEMBER PROFILE(myprofile.php). AFTER MEMBER LOG IN SESSION ARE REGISTERED. NOW THE PROBLEM COMES,IF MEMBER MOVES TO ANOTHER PAGE AND IF HE WANT TO BE BACK TO HIS PROFILE BY CLICKING THE BACK BUTTON,IT SHOWS THAT U MUST REFRESH A PAGE. I TRIED … |
 | Hi there I'm new to using sessions and I'd like some input on what the best method is for my situation. The site I'm building requires a shopping cart. A very simple one I might add. There will be no credit card facility or login system (explained in next paragraph). …  |
| | [COLOR="Red"]When I open my page I get this error:[/COLOR] [code] Parse error: syntax error, unexpected $end in /home/a9617139/public_html/order2.php on line 215[/code] [COLOR="Red"]Here's all of the code for the page:[/COLOR] [code] <? session_start(); ?> <script language="JavaScript" type="text/javascript"><!-- function placeFocus() { if (document.forms.length > 0) { var field = document.forms[0]; for (i … |
| | [COLOR="Red"]I have a code and it comes up with this error:[/COLOR] [code]Parse error: syntax error, unexpected T_VARIABLE in /home/a9617139/public_html/order2.php on line 1[/code] [COLOR="Red"]I don't know why it does. This is my code for that page:[/COLOR] [code] <?php session_start(); ?> <script language="JavaScript" type="text/javascript"><!-- function placeFocus() { if (document.forms.length > 0) { …  |
| | These are the directions: Recursive Descent Parsing Consider the following BNF grammar: E -> T + E | T - E | T T -> P * T | P / T | P P -> I | (E) I -> a | b | ... | y | z … |
| | Hi there I have a problem with sessions at the moment. My aim is to be able to use sessions with out getting those ugly url's. In my php.ini session.use_trans_sid is on and session.use_cookies is on. I'm using ini_set("url_rewriter.tags",""); to stop the server from creating url's with PHPSESSID=bunchofrandomnumbersandlettershere which works … |
| | I am new to PHP I need a little help in my php login script... I had 3 pages 1. index.html (user type username and password ) 2. login.php 3. logout.php ie [B][U]index.html[/U][/B] <html> /Main Page /////// <body> <form action="login.php" method="post"> <input name="uname" type="text" id="uname" /> <input name="pass" type="text" id="pass" …  |
| | I'd like to write a shell script that'd parse data from a pipe and then ask the user questions. ie: [code]echo "Ann Bob Charlie" | checkuser.sh checkuser.sh starting Ann is OK. Bob is not in the system. Add Bob? (y/n): [/code] I know a couple ways to read from a …  |
| | I am trying to get Google to show my title and meta description but it shows the description from dmoz.com. I have the meta data "noodp" in my <head> but it is under some JavaScript. Also the page redirects due to session id passing and cookie sessions for tracking purpose. …  |
| | Hello I had problem I want to delete row from my datatable through asp:linkbutton. How can I do this. I had the following code, but it adds another row to the table protected void delCart(object s, DataTableNewRowEventArgs e) { dt = (DataTable)Session["Cart"]; dt.Rows[e.Item.ItemIndex].Delete(); //dt.Rows(e.Item.ItemIndex).Delete(); int CartItem = (int)Session["cartItem"]; CartItem = … |
| | Hello pipo Iam pretty new at php.I implemented a log in page as shown below: <?php session_start(); include("./connect.php"); // start the session $errorMessage = ''; if (isset($_POST) && isset($_POST)) { //--------------------------------------------------------------- if (isset($_POST)) { // if form has been submitted //check out the fields if (isset($_POST) || isset($_POST)) { // … |
| | Hi i am new here and trying to fix a relative's computer First it would not boot windows so i had to reinstall the boot files from winxp cd then once i was able to boot i ran over 6 scans from different companies (avg8, ad aware, pc doctor) i … |
| | A user will select a tournament to register for, then add a team, then I store the following into a session: $teamID; $tournyID; $gatefee; $cost; When they click add to cart I update the session using this: $_SESSION['cart'][]['team'] = $teamID; $_SESSION['cart'][]['tournament'] = $tournyID; $_SESSION['cart'][]['gatefee'] = $gatefee; $_SESSION['cart'][]['cost'] = $cost; My …  |
| | So I am completely new to ASP .NET and my first page needs to be a log in page. I have a database in SQL 2000 that has a table called tblEmployee. This table holds usernames, passwords, and group security details. I need to grab quite a few fields from …  |
| | i am building a web chat application for mobiles. Registration form for new users currently includes username , password , re-enter password and a submit button to send all to a form bean. i am having problem to create a link or a button to send the input of 'username' … |
| | I am facing problem while retrieving values from the jsp page. my database structure is as follows: ----------------------------------------------------------------------- m_emp_no|from_date|to_date|approver|status| ________________________________________ 1002 | 22/9/2008 | 23/9/2008|1003 |pending 1004 | 29/9/2008 | 30/9/2008|1003 |pending 2044 | 15/9/2008 | 16/9/2008|3076 |pending -------------------------------------------------------------------------- I am retrieving values from database properly using the following sql … |
| | Hello, Im using ASP.NET as front end and SQL Server as back-end. and i couldnt navigate the records. im not getting correct way. more over im having some doubts in the dataset also. normally im designing the dataset by picking the dataset from "Add New Items" only. because, if i … |
| | Hi I am having problems with sessions. When using Internet Explorer I can pass sessions to other pages. I cannot pass sessions when I use Mozilla Firefox. //at the top of the page session_start(); //value passed $last_login = $_SESSION['s_last_login'];//last user login history PHP.ini: //This is my PHP.ini file session configuration … |
| | Always get warning when using raw type Lists/Sets/Iterators etc. [code] public java.util.List /* <-- Warning here */ getUsersByAge(int minAage) { org.hibernate.Query q = session.createQuery("from User u where u.age >= :minAge"); q.setInteger("minAge", minAage); return q.list(); /* <-- Warning here */ } [/code] I've chaged this by [code] public java.util.List<User> getUsersByAge(int minAage) … |
| | I want know more about session and cookies. How it maintain and what is it use using php. where all session variables are stored in differnet web server. How session is maintained in Apache server and ISS server. All depth information about server with example. Please give me some url … |
| | I have a form where I am using an image as the submit button. When I click on the button the form submits however when I press 'enter' the page simply refreshes. In my PHP code I use the submitok_x value to check the x co-ordinate value - if it … |
| | Hello All, I need to pass two session varaibles from gridview to open another page ("Detail.aspx") I got the session varaibles work with the "AutoGenerateSelectButton = true". But I need to use an image instead and not sure where to start. I got the images to display and open the … |
 | I have a jsp page to take input from user and want to store values in database with the confirmation message on the same jsp page . But I already have stored an array list in session during processing of other pages of other modules of my project . Now …  |
| | I read jsp tutorial by peter_budo on database connectivity using MVC model in jsp then I tried to create a registration page but I have errors on my page . Please help me correct them. I here have 1. registration.jsp - as interface for taking input 2. RegisterServlet.java - as … |
| | Hi guys, Once again here i am asking for your wise knowledge, i am having porblems with deleting a record. I can update the record but when i am trying to delete it i cant it it does nothing here is my code [code] <?php require_once('Connections/hello.php'); ?> <?php if (!isset($_SESSION)) … |
The End.